UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:MATE2-K
HGNC Symbol:SLC47A2
HGNC Description:solute carrier family 47 (multidrug and toxin extrusion), member 2
HGNC ID:26439
Superfamily:SLC
Chromosome:Chr.17(-): 19581626-19622990 GRCh37
Location:17p11.2
OMIM:609833
OMIM Phenotype:None
Accessions:None
Nucleotide RefSeq:NM_001099646
Protein RefSeq:NP_001093116
Entrez:146802
Ensembl:ENSG00000180638
Isoforms:6
Evidence:None
Tissues:None
Type:protein-coding
Sets:None
PharmGKB ID:PA162403847
HPRD ID:08710
Substrates:None
Trivial Names:MATE2, MATE2K, MATE2-B, MATE2-K
Transcripts:NM_001099646.1 [Chr.17(-): 19581628-19620043 GRCh37]
NM_152908.3 [Chr.17(-): 19581628-19620043 GRCh37]
XM_005256471.1 [Chr.17(-): 19581626-19622982 GRCh37]
XM_005256472.1 [Chr.17(-): 19581626-19620789 GRCh37]
NM_001256663.1 [Chr.17(-): 19581628-19620043 GRCh37]
XM_005256473.1 [Chr.17(-): 19605395-19619977 GRCh37]
ENST00000325411 [Chr.17(-): 19581601-19619919 GRCh37]
ENST00000350657 [Chr.17(-): 19581632-19620043 GRCh37]
ENST00000433844 [Chr.17(-): 19606410-19620043 GRCh37]
ENST00000456947 [Chr.17(-): 19619037-19622150 GRCh37]
ENST00000463318 [Chr.17(-): 19581628-19622292 GRCh37]
ENST00000467379 [Chr.17(-): 19608324-19620756 GRCh37]
ENST00000467609 [Chr.17(-): 19581628-19619879 GRCh37]
ENST00000483510 [Chr.17(-): 19617760-19619965 GRCh37]
ENST00000574220 [Chr.17(-): 19606423-19618191 GRCh37]
ENST00000574239 [Chr.17(-): 19581834-19619886 GRCh37]
Annotation History:View Events (37)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC47A2.

Variant Data

View all PMT variants for SLC47A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC47A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC47A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: 5UTR
Promoter
PDE
19620034 GRCh37
19560626 NCBI36
10-166
CAACTTGTGGGATGAGCCCTGCCTC C → G TAGGGCACTGAGTCCCTGCTGCCAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
63
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE4 pubs
19619998 GRCh37
19560590 NCBI36
46-130
CTGATGAGTAAGGGGCAGGAGGAGG G → A GCTACCATGGCAACTTGTGGGATGA
Increased basal promoter activity. Patients with diabetes and homozygous for variant showed reduced response to metformin. PMID: 21956618.
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
35
24
6
0.277
130
36
24
5
0.262
136
17
36
15
0.485
132
27
33
6
0.341
PMT-272
Exon 1: 5UTRPDE
19619914 GRCh37
19560506 NCBI36
130-46
ACCCTGCACGCCTGAGCGCCTGCAC G → A GCCAGCTTTGTCCAGCGAGCCACCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
19619913 GRCh37
19560505 NCBI36
131-45
TACCCTGCACGCCTGAGCGCCTGCA C → T GGCCAGCTTTGTCCAGCGAGCCACC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
 PDE
19619724 GRCh37
19560316 NCBI36
  
CTCAGCTTCCTCCACTCCCTACCTG C → T CCCCCAGCTCCTCCTCCTTACCAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
65
0
0
0.000
136
65
3
0
0.022
132
66
0
0
0.000
PMT-272
 PDE
19619703 GRCh37
19560295 NCBI36
  
CAAGGCAGACACCCTCAGCCTCTCA G → A CTTCCTCCACTCCCTACCTGCCCCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
 
19618582 GRCh37
19559174 NCBI36
  
CGGGGCCACAGGTGCCCACACAGCC G → A AGCCCTGCAAGACAGGCCTCTCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
128
64
0
0
0.000
136
56
11
1
0.096
130
63
1
1
0.023
PMT-272
Exon 2: Coding
19618447 GRCh37
19559039 NCBI36
382207
TACTCACGGCCACCGCGAGGGTCAC C → T GATGCCAGCTCCACCTTGCCCAGGT
+69
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
128
64
0
0
0.000
136
63
5
0
0.037
130
65
0
0
0.000
PMT-272
 
19618108 GRCh37
19558700 NCBI36
  
ACTCCGCAGACATTGACAAACTGGC G → A CCACACACAGGAGGAAACAAGAGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
130
63
2
0
0.015
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 
19618012 GRCh37
19558604 NCBI36
  
GCTCTGCCCTTGCCTGGCTTCCTGC C → T CAGCTCCAGGAGGCCACCCACCTGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
134
65
2
0
0.015
PMT-272
 
19618007 GRCh37
19558599 NCBI36
  
AATTGGCTCTGCCCTTGCCTGGCTT C → T CTGCCCAGCTCCAGGAGGCCACCCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
61
2
2
0.046
130
65
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
19617393 GRCh37
19557985 NCBI36
  
CCAGGCTGTGGTCACCAGAGGCCGC C → A GGGTCCGCCACACACCGCTGGCGCC
- 
 
n=
C/C=
C/A=
A/A=
A=
118
17
28
14
0.475
124
31
26
5
0.290
128
14
32
18
0.531
118
22
31
6
0.364
PMT-272
 PDE
19617350 GRCh37
19557942 NCBI36
  
CTGGCGCCGCTGACAGCCCGCTCCC C → T GCGCGGGATTTAGGAATGTCCCGGG
- 
 
n=
C/C=
C/T=
T/T=
T=
118
58
1
0
0.008
124
62
0
0
0.000
128
64
0
0
0.000
118
59
0
0
0.000
PMT-272
 PDE
19617346 GRCh37
19557938 NCBI36
  
CGCCGCTGACAGCCCGCTCCCCGCG C → A GGGATTTAGGAATGTCCCGGGCAGT
- 
 
n=
C/C=
C/A=
A/A=
A=
118
58
1
0
0.008
124
62
0
0
0.000
128
64
0
0
0.000
118
59
0
0
0.000
PMT-272
Exon 4: CodingPDE
19617254 GRCh37
19557846 NCBI36
502327
GCAGCCCCAACAAGAAGCACGTGGG C → T GTGATCCTGCAGCGGGGCGCGCTGG
-109
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
118
56
3
0
0.025
124
62
0
0
0.000
128
64
0
0
0.000
118
57
2
0
0.017
PMT-272
Exon 4: CodingPDE
19617236 GRCh37
19557828 NCBI36
520345
ACGTGGGCGTGATCCTGCAGCGGGG C → A GCGCTGGTCCTGCTCCTCTGCTGCC
-115
Gly = Gly
n=
C/C=
C/A=
A/A=
A=
118
18
28
13
0.458
124
30
26
6
0.306
128
16
33
15
0.492
118
22
31
6
0.364
PMT-272
 PDE
19617113 GRCh37
19557705 NCBI36
  
GGTGCGCTGGGCTCCGGCTGGGGAG G → C TGGGGCTTGCTGGGAAACCCGGGCC
- 
 
n=
G/G=
G/C=
C/C=
C=
118
59
0
0
0.000
124
62
0
0
0.000
128
63
1
0
0.008
118
59
0
0
0.000
PMT-272
 PDE
19617087 GRCh37
19557679 NCBI36
  
TGGGGCTTGCTGGGAAACCCGGGCC G → A CCGAGGGAAACCCTGAAGATGCCCA
- 
 
n=
G/G=
G/A=
A/A=
A=
118
59
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
118
58
1
0
0.008
PMT-272
 PDE
19616153 GRCh37
19556745 NCBI36
  
GTCCTCCAGGACTGGGTGCTCGGCC G → A CTGTCCCAGGGTCTCAGCCAGGACT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
132
66
0
0
0.000
136
63
5
0
0.037
134
67
0
0
0.000
PMT-272
 PDE
19616102 GRCh37
19556694 NCBI36
  
CTCCGGAGCTGACCAGGCTGTGGCC C → G GGGGAGGCAGGGCCCTCTCCCCTGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
63
0
0
0.000
132
66
0
0
0.000
136
63
5
0
0.037
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 5: CodingPDE1 pub
19616017 GRCh37
19556609 NCBI36
660485
CGCTCAGCAAACAGGGGCACCTACC G → A GAAGTCCTGGAATGAAAATCATTAC
Reduced metformin uptake and protein expression levels in transfected HEK-293 cells. PMID: 21956618.
+162
Pro → Leu
(D=98)
n=
G/G=
G/A=
A/A=
A=
126
56
7
0
0.056
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
19611823 GRCh37
19552415 NCBI36
  
GTCCCAGCCTCTTCCAACTCCTCAA C → T AGGGATGGCTGAAGGGGCAGGAGGA
- 
 
n=
C/C=
C/T=
T/T=
T=
124
58
4
0
0.032
124
62
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
19611230 GRCh37
19551822 NCBI36
  
ACCGCCCTGCCTGAGAGAGAGGTGG C → T TCTGGCGGCCAGCCCGTGTGGGGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 PDE
19611226 GRCh37
19551818 NCBI36
  
TGCCACCGCCCTGCCTGAGAGAGAG G → A TGGCTCTGGCGGCCAGCCCGTGTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 PDE
19611184 GRCh37
19551776 NCBI36
  
GGGTAAGGAGGGAGAACAGGGCTGC G → A ACTGATGCCAACTCTCTGCCACCGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 8: CodingPDE
19611084 GRCh37
19551676 NCBI36
877702
CTGCCCACGTCTCCAGGTGCAGCTT C → T TTCAGCACAATGTAGAGAAGGAGGA
+234
Lys = Lys
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
19610990 GRCh37
19551582 NCBI36
  
ACTGCACCCTCTGCCTGCTGACCAC C → G CTGCCCCAAGGCTAGGGCAGCACCA
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
19610975 GRCh37
19551567 NCBI36
  
CCTCCAACAGGCTCTACTGCACCCT C → T TGCCTGCTGACCACCCTGCCCCAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
134
67
0
0
0.000
PMT-272
 PDE
19610881 GRCh37
19551473 NCBI36
  
GCTCTGCATCGTGACACCTTGGGTG G → A AGGGACTCTGGGCCCTTGGGGCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
19610104 GRCh37
19550696 NCBI36
  
GGAATGAGGTGGGCAAGCAGGGCAG G → A CTGTCAGCTCATGGGGCCTCTGTTT
- 
 
n=
G/G=
G/A=
A/A=
A=
130
50
14
1
0.123
130
34
25
6
0.285
136
17
35
16
0.493
136
26
36
6
0.353
PMT-272
 PDE
19609947 GRCh37
19550539 NCBI36
  
GCTTCCTCATGGGTACGTGGAAGAG G → C ATGGGGGGCGCAATGGCGTGTGGGC
- 
 
n=
G/G=
G/C=
C/C=
C=
130
4
27
34
0.731
130
7
32
26
0.646
136
0
6
62
0.956
136
6
30
32
0.691
PMT-272
 PDE
19609901 GRCh37
19550493 NCBI36
  
TGGGCGGCTCACCCAGCCCAGAAGC C → T CCCTCCCCAGGATGGCGGCTCACCC
- 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
PMT-272
 PDE
19609885 GRCh37
19550477 NCBI36
  
CCCAGAAGCCCCCTCCCCAGGATGG C → T GGCTCACCCATCCCAGAAGCCCCCT
- 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
19609875 GRCh37
19550467 NCBI36
  
CCCTCCCCAGGATGGCGGCTCACCC A → G TCCCAGAAGCCCCCTCCCCAGGATG
- 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
130
65
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
19609813 GRCh37
19550405 NCBI36
  
GCCCCCTTCCAGCTTCACTGGCCAG G → - CCCTCAGGCTTGGACCCAGAGAACA
- 
 
n=
G/G=
G/-=
-/-=
-=
130
64
1
0
0.008
130
63
2
0
0.015
136
68
0
0
0.000
136
65
3
0
0.022
PMT-272
 PDE
19608883 GRCh37
19549475 NCBI36
  
ACACCCAGACCCTGCGCCGACAGGA C → T GCTGCTTTGCTTTGGGGACTCAGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
 PDE
19608835 GRCh37
19549427 NCBI36
  
AGCAGCCCTAGAGAAGAGGCCCGCC G → A TGAGTCCGGCCCGCAGCCCCAGACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDEI
19608773 GRCh37
19549365 NCBI36
1060885
CCATGTAGGTCACAGTGGCCACCTC G → A TAGATGACAGCCTGGGCAGAGAGAT
+295
Tyr = Tyr
n=
G/G=
G/A=
A/A=
A=
130
19
22
24
0.538
134
38
13
16
0.336
136
12
10
46
0.750
132
22
16
28
0.545
PMT-272
 PDE
19608713 GRCh37
19549305 NCBI36
  
CTATGACACCTCCAGCCATCAGGTG G → A GGGATGTGGGGAAGGCACCCCTGCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
61
4
0
0.031
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
19608699 GRCh37
19549291 NCBI36
  
AGCCTGCCCCCCTCCTATGACACCT C → T CAGCCATCAGGTGGGGGATGTGGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
19608648 GRCh37
19549240 NCBI36
  
ACGAGAGGCCCGGGGAGGGTCCTTC G → A GGAGACAGAGATAGCTTCAGGTGAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
58
6
1
0.062
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
19607598 GRCh37
19548190 NCBI36
  
ACGTGAGCGGGAAGGCAGAGCAGAT C → T TCAGGCATGCAGTGTAAGAGGCACG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDE
19607499 GRCh37
19548091 NCBI36
  
GCTGAGCCCCAAGGGAATCTGGGAT C → G AAAGATAAGAAAGCACTGTCAGTGG
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
65
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
130
65
0
0
0.000
PMT-272
Exon 11: CodingPDEI
19607432 GRCh37
19548024 NCBI36
1144969
CCGAGCGCTTGGCCTGCACAGTATC C → T GCAGCCCCCAGAGCCATCCCCACTC
+323
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
130
43
18
4
0.200
130
62
3
0
0.023
136
68
0
0
0.000
130
60
5
0
0.038
PMT-272
 PDE
19606377 GRCh37
19546969 NCBI36
  
TGGGAACCACTTTGACATTTTCCAA G → C AGTCAGCACAGAAAACTGATTACCT
+ 
 
n=
G/G=
G/C=
C/C=
C=
128
57
7
0
0.055
120
60
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
19606273 GRCh37
19546865 NCBI36
  
ATAGACAGAAGTTGGCTTCCTCTCA G → A TGAGAGCCAAGCCTGGGCTCTTCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
63
1
0
0.008
120
60
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
19606128 GRCh37
19546720 NCBI36
  
CCCCACACAAATGTAACTGGCACTG C → A TAGCCCAGAGTTTTCTGTGTCTGTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
128
58
6
0
0.047
120
60
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
19585172 GRCh37
19525764 NCBI36
  
CCAAGACAGGTCAGATCACTTGTCC A → G TGTTACACAGAAGTAACTGTGTTTT
+ 
 
n=
A/A=
A/G=
G/G=
G=
122
61
0
0
0.000
116
56
2
0
0.017
122
61
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: CodingPDEI
19584971 GRCh37
19525563 NCBI36
13521177
TGCTTCCCAGTTCCTCTCAGAACTC C → T GCCATAGACACACTAGGAGGGGAGA
Reduced metformin uptake and protein expression levels in transfected HEK-293 cells. PMID: 21956618.
+393
Gly → Arg
(D=125)
n=
C/C=
C/T=
T/T=
T=
122
61
0
0
0.000
116
57
1
0
0.009
122
61
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDE
19584822 GRCh37
19525414 NCBI36
  
GGAACAATGTCCGACGACCACCCAG G → T CCTCTCCCGACTTCCTCACACCACA
+ 
 
n=
G/G=
G/T=
T/T=
T=
122
61
0
0
0.000
116
58
0
0
0.000
122
60
1
0
0.008
130
65
0
0
0.000
PMT-272
Exon 15: CodingPDE
19584752 GRCh37
19525344 NCBI36
14951320
AGGCAGCAGTTGCCAGGAAGACACA G → C GCCAGCATGCCCAGCCAGAGGCCTG
+440
Ala = Ala
n=
G/G=
G/C=
C/C=
C=
122
61
0
0
0.000
116
57
1
0
0.009
122
61
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDE
19583656 GRCh37
19524248 NCBI36
  
AAATACTAAAAAATTAGCTGGGCAT G → A GTGGCGCATGTCTGTAGTCCCAGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
128
64
0
0
0.000
PMT-272
 
19583643 GRCh37
19524235 NCBI36
  
CTGTCTCTACCAAAAATACTAAAAA A → C TTAGCTGGGCATGGTGGCGCATGTC
+ 
 
n=
A/A=
A/C=
C/C=
C=
128
64
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
128
64
0
0
0.000
PMT-272
 PDE
19583420 GRCh37
19524012 NCBI36
  
CAGTTCACCCCTTCACTGCTAGCCT C → T GCATTCTCTGTTTTTAAAACATTGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
63
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
19583177 GRCh37
19523769 NCBI36
  
ATAGCTTGGGCTTGTACAATTTCCA A → G TTGCATGAGGCACAGAGGGCAGACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
60
4
0
0.031
134
67
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
19583119 GRCh37
19523711 NCBI36
  
TAGATGTTGTTGTCTTCCTGGTGCT T → C AGGACATCATTTTCATAATAATGGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
128
63
1
0
0.008
134
65
2
0
0.015
134
67
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
19582278 GRCh37
19522870 NCBI36
  
CAGGGGTCAGAGGGAGAGCTTTGGC C → G TTGGAATCGGGAAACCTAGGTTAAC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
65
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 PDE
19582233 GRCh37
19522825 NCBI36
  
TGCCTGTAGCCACTGCGGAAGCAAA C → T AGGAGCAAACTCAGCAGGTCAGGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
130
64
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
 PDE
19582223 GRCh37
19522815 NCBI36
  
CCAGGGGAACTGCCTGTAGCCACTG C → T GGAAGCAAACAGGAGCAAACTCAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
68
0
0
0.000
136
68
0
0
0.000
136
65
3
0
0.022
136
68
0
0
0.000
PMT-272
Exon 17: CodingPDE
19582186 GRCh37
19522778 NCBI36
16891514
GTGGCACTCAGACCTTGAATACGTT G → A TCAAGGTAATGCCAGGGGAACTGCC
+505
Thr → Ile
(D=89)
n=
G/G=
G/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 17: CodingPDE
19582128 GRCh37
19522720 NCBI36
17471572
GTCTGCTGGTAGGAGCTGAAAGGGC G → A TGGGCCTCCTCTGGAGTCCTGAAGA
+524
His = His
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
Exon 17: CodingPDE
19582127 GRCh37
19522719 NCBI36
17481573
AGTCTGCTGGTAGGAGCTGAAAGGG C → T GTGGGCCTCCTCTGGAGTCCTGAAG
+525
Ala → Thr
(D=58)
n=
C/C=
C/T=
T/T=
T=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 17: CodingPDE
19582029 GRCh37
19522621 NCBI36
18461671
GCCTGGTGGCTAGGATCCTGACCGT G → A AGCCCCACCATCAGTGTGGCTGACG
+557
Leu = Leu
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19581766 GRCh37
19522358 NCBI36
2109 
CTCGTGCAGTTGGCTGATGTCTTCT G → A TAGAGCAGTCCAAGTCACAGAAGAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
63
5
0
0.037
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
Exon 17: 3UTRPDE
19581687 GRCh37
19522279 NCBI36
2188 
GGTTTTTGTGATTTTATCTGCAGTG T → A CCCATTTGAAGCCATTTACATTATT
+ 
 
n=
T/T=
T/A=
A/A=
A=
136
68
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
136
68
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.