UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SGLT1
HGNC Symbol:SLC5A1
HGNC Description:solute carrier family 5 (sodium/glucose cotransporter), member 1
HGNC ID:11036
Superfamily:SLC
Chromosome:Chr.22(+): 32439019-32509016 GRCh37
Location:22q12.3
OMIM:182380
OMIM Phenotype:Glucose/galactose malabsorption
Accessions:M24847
Nucleotide RefSeq:NM_000343
Protein RefSeq:NP_000334
Entrez:6523
Ensembl:ENSG00000100170
Isoforms:2
Evidence:Substrate In Vitro Evidence: 1. Glucose and Galactose - Oocytes - Wright EM et al, Acta Physiologica Scandinavica 1998: 257-264 2. Quercetin-3-glucoside - brush border membrane of rat small intestine - Wolffram S et al, Journal of Nutrition 2002: 630-635 3. methyl a-D-glucopyranoside - transport in E. coli - Quick M et al, PNAS 2002: 8597-8601 Substrate In Vivo Evidence: 1. Inhibitor - Phloridzin, Deoxyrhapontin, rhapontin, 5-Br-3-indolylgactopyranoside - Hirayama B et al, British Journal of Pharmacology 2001: 484-495 2. Inhibitor - quercetin-4'-glucoside - Ader P et al, Cancer Letters 2001: 175-180 Tissue Distribution Evidence: 1. Small intestine >> trachea, kidney, heart - RNAse Protection Assay - Wright EM et al, European Journal of Physiology 2003 (online) 2. Duodenum, Jejunum, ileum >> outer stripe (kidney), remaining cortex (kidney) >>lung - Northern Blot, Lee WS et al, JBC, 1994: 12032-12039
Tissues:small intestine, kidney, heart
Type:protein-coding
Sets:II,V
PharmGKB ID:PA308
HPRD ID:01668
Substrates:Glucose, galactose, quercitin-3-glucoside
Trivial Names:NAGT, SGLT1, D22S675
Transcripts:NM_000343.3 [Chr.22(+): 32439019-32509016 GRCh37]
NM_001256314.1 [Chr.22(+): 32455157-32509016 GRCh37]
ENST00000266088 [Chr.22(+): 32439019-32509016 GRCh37]
ENST00000477969 [Chr.22(+): 32480836-32498194 GRCh37]
ENST00000486394 [Chr.22(+): 32479038-32482313 GRCh37]
ENST00000543737 [Chr.22(+): 32455178-32506346 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC5A1.

Variant Data

View all PMT variants for SLC5A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC5A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC5A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 1: CodingPDE
32439274 GRCh37
30769274 NCBI36
2566
AAGGACGCAACGCTGCCACCATGGA C → T AGTAGCACCTGGAGCCCCAAGACCA
+2
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
39
11
0
0.110
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
32439286 GRCh37
30769286 NCBI36
26818
CTGCCACCATGGACAGTAGCACCTG G → A AGCCCCAAGACCACCGCGGTCACCC
+6
Trp → STOP
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
32439311 GRCh37
30769311 NCBI36
29343
GAGCCCCAAGACCACCGCGGTCACC C → T GGCCTGTTGAGACCCACGAGCTCAT
+15
Arg → Trp
(D=101)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 1: CodingPDE
32439318 GRCh37
30769318 NCBI36
30050
AAGACCACCGCGGTCACCCGGCCTG T → C TGAGACCCACGAGCTCATTCGCAAT
+17
Val → Ala
(D=64)
n=
T/T=
T/C=
C/C=
C=
160
75
5
0
0.031
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE
32439365 GRCh37
30769365 NCBI36
34797
CAATGCAGCCGATATCTCCATCATC G → A TTATCTACTTCGTGGTAGTGATGGC
+33
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32439453 GRCh37
30769453 NCBI36
  
GGTGGGGAGGGTGCGCACAGAGGAG G → - AGCAATGGCCTCGCTGAGCTGCAAG
+ 
 
n=
G/G=
G/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32439454 GRCh37
30769454 NCBI36
  
GTGGGGAGGGTGCGCACAGAGGAGG A → - GCAATGGCCTCGCTGAGCTGCAAGG
+ 
 
n=
A/A=
A/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32439455 GRCh37
30769455 NCBI36
  
TGGGGAGGGTGCGCACAGAGGAGGA G → - CAATGGCCTCGCTGAGCTGCAAGGG
+ 
 
n=
G/G=
G/-=
-/-=
-=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32445855 GRCh37
30775855 NCBI36
  
AGTGGGTAGAAGAAGGTGCACGAAT G → C GGGAGGTATGTCCTTTTGGCTGGCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
32445893 GRCh37
30775893 NCBI36
  
CTTTTGGCTGGCAAGGCCACTCTTC T → C AGTTTTCGATTACATTTTTGACCCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
75
5
0
0.031
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDE1 pubI
32445946 GRCh37
30775946 NCBI36
402152
CCTCCTCAGGCTATGTTTTCCACCA A → G TCGTGGGACTGTTGGAGGCTTCTTC
+51
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
 PDEIA
32463083 GRCh37
30793083 NCBI36
  
GCTGGAAGGAGCCTTAGCAGTCAAC C → T AGTTCAATCTATGCTCAGAGGAGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
158
61
17
1
0.120
160
80
0
0
0.000
120
60
0
0
0.000
98
49
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32464460 GRCh37
30794460 NCBI36
  
CCCTCTGGTCACTGTGGCTGGCAGT G → C ACCTCCCTCGCACCCCATGCAGGTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32477846 GRCh37
30807846 NCBI36
  
CCCTCCTAACTCCGCCTCTCCTCTC C → CC TTCCAGGCAGACATCTTCTCGGGGG
+ 
 
n=
C/C=
C/CC=
CC/CC=
CC=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32479054 GRCh37
30809054 NCBI36
  
AGGTCAGATGTGTTGTCTTCTTGCC T → A GCTTAGGGGGCCTGGCGGCGGTGAT
+ 
 
n=
T/T=
T/A=
A/A=
A=
158
78
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE
32479085 GRCh37
30809085 NCBI36
858608
GGGGGCCTGGCGGCGGTGATTTACA C → T GGACACCTTGCAGACGGTGATCATG
+203
Thr → Met
(D=81)
n=
C/C=
C/T=
T/T=
T=
158
78
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32479199 GRCh37
30809199 NCBI36
  
GAGCAGAGGTAGAGGGCCTCAGGAA G → A AGGAAGGCAAGTCCAGCCTCTCTAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
158
78
1
0
0.006
158
79
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32479237 GRCh37
30809237 NCBI36
  
CCAGCCTCTCTACCTGCTTGCCAGA C → T TAGGCAGTGAGCTGAGGCATGCTCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
158
79
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 9: CodingPDE
32480943 GRCh37
30810943 NCBI36
1192942
ATATGTCTCACGTGAAGGGTGGCTG C → T ATCCTGTGTGGGTATCTAAAGCTGA
+314
Cys = Cys
n=
C/C=
C/T=
T/T=
T=
158
79
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
32482163 GRCh37
30812163 NCBI36
  
AAAGAAGGTGAATTTTGGAAATATT T → C CCCCAATGTCTGCTTGCTGACGTGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
158
79
0
0
0.000
118
59
0
0
0.000
98
48
1
0
0.010
8
4
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 10: CodingPDE
32482277 GRCh37
30812277 NCBI36
13421092
GTACCAAGGTTGGCTGTACCAACAT C → T GCCTATCCAACCTTAGTGGTGGAGC
+364
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
160
75
5
0
0.031
158
79
0
0
0.000
118
59
0
0
0.000
98
49
0
0
0.000
8
4
0
0
0.000
Set-II
 PDEI
32482321 GRCh37
30812321 NCBI36
  
GTGGAGCTCATGCCCAATGGTGAGA T → G TCTTTCTTGGGAGGTTGGTAGAGTC
+ 
 
n=
T/T=
T/G=
G/G=
G=
160
5
22
53
0.800
158
34
24
21
0.418
118
40
16
3
0.186
98
31
16
2
0.204
8
2
0
2
0.500
Set-II
 PDE
32487590 GRCh37
30817590 NCBI36
  
TGTTATGTGCCACTCAAAAATCCTT C → T TCTTCCAGGACTGCGAGGCCTGATG
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 11: CodingPDE1 pub
32487700 GRCh37
30817700 NCBI36
14811231
CACCCTCTTCACCATGGACATCTAC G → A CCAAGGTCCGCAAGAGAGCATCTGA
+411
Ala → Thr
(D=58)
n=
G/G=
G/A=
A/A=
A=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
Exon 11: CodingPDE
32487705 GRCh37
30817705 NCBI36
14861236
TCTTCACCATGGACATCTACGCCAA G → A GTCCGCAAGAGAGCATCTGAGAAAG
+412
Lys = Lys
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 11: CodingPDEI
32487744 GRCh37
30817744 NCBI36
15251275
CATCTGAGAAAGAGCTCATGATTGC C → T GGAAGGTAAATGCAGCTTCCCCCAA
+425
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
Exon 12: CodingPDE
32495331 GRCh37
30825331 NCBI36
16921442
CTTGCTATTTTCTGGAAGAGAGTCA A → G TGAGCCAGTAGGTATCATCTGGGCA
+481
Asn → Ser
(D=46)
n=
A/A=
A/G=
G/G=
G=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
90
45
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32495448 GRCh37
30825448 NCBI36
  
TCTATTTCCCAGAGATCTTGAGCAG A → G CACGGATGTGCTGCTGAGGGTTTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
90
45
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 13: CodingPDE
32498115 GRCh37
30828115 NCBI36
18061556
TGCATGGAGCCCAGCAACTGTCCCA C → T GATTATCTGTGGGGTGCACTACTTG
+519
Thr → Met
(D=81)
n=
C/C=
C/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 13: CodingPDE
32498140 GRCh37
30828140 NCBI36
18311581
CGATTATCTGTGGGGTGCACTACTT G → T TACTTTGCCATTATCCTCTTCGCCA
+527
Leu → Phe
(D=22)
n=
G/G=
G/T=
T/T=
T=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 13: CodingPDE
32498152 GRCh37
30828152 NCBI36
18431593
GGGTGCACTACTTGTACTTTGCCAT T → G ATCCTCTTCGCCATTTCTTTCATCA
+531
Ile → Met
(D=10)
n=
T/T=
T/G=
G/G=
G=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32498251 GRCh37
30828251 NCBI36
  
TGAGTATCCATTTAGGGGATCTGTC C → T TTGTTTCATGTTCACACTGCAATGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
32500768 GRCh37
30830768 NCBI36
  
TTCTGTTGACCTGTTCTGCCTTCTC T → C GCAGCTCTACCGTCTGTGTTGGAGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
75
5
0
0.031
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 14: CodingPDE
32500800 GRCh37
30830800 NCBI36
19431693
CTACCGTCTGTGTTGGAGCCTGCGC A → G ACAGCAAAGAGGAGCGTATTGACCT
+565
Asn → Asp
(D=23)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
4
2
0
0.167
Set-II
 PDE
32500951 GRCh37
30830951 NCBI36
  
CAACAACAAGACTTTACTGAAGTTC T → - TCCCTAAATAATTTTATCAGAGCTC
+ 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32500952 GRCh37
30830952 NCBI36
  
AACAACAAGACTTTACTGAAGTTCT T → - CCCTAAATAATTTTATCAGAGCTCA
+ 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32500953 GRCh37
30830953 NCBI36
  
ACAACAAGACTTTACTGAAGTTCTT C → - CCTAAATAATTTTATCAGAGCTCAG
+ 
 
n=
C/C=
C/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32505914 GRCh37
30835914 NCBI36
  
AGATGCTTCATGGTGTGGCTTCTCC C → T CTGAAAACTTTTCTAGTCCATCCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
32505956 GRCh37
30835956 NCBI36
  
TCCATCCTGCTTCTGTGTCCAATAA T → C TCTTCTATGCCTTTGCCCAGAAACA
+ 
 
n=
T/T=
T/C=
C/C=
C=
160
73
7
0
0.044
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 15: CodingPDE
32506041 GRCh37
30836041 NCBI36
20861836
GAGCCTATGACCTATTTTGTGGGCT A → G GAGCAGCACGGTGCACCCAAGATGA
+612
Leu = Leu
n=
A/A=
A/G=
G/G=
G=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 15: CodingPDE1 pub
32506050 GRCh37
30836050 NCBI36
20951845
ACCTATTTTGTGGGCTAGAGCAGCA C → G GGTGCACCCAAGATGACTGAGGAAG
+615
His → Gln
(D=24)
n=
C/C=
C/G=
G/G=
G=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
Exon 15: CodingPDE
32506104 GRCh37
30836104 NCBI36
21491899
AGAAAGCCATGAAGATGAAGATGAC G → A GACACCTCTGAGAAGCCTTTGTGGA
+633
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
160
75
5
0
0.031
160
70
10
0
0.063
120
59
1
0
0.008
100
47
3
0
0.030
12
4
1
1
0.250
Set-II
Exon 15: CodingPDE
32506143 GRCh37
30836143 NCBI36
21881938
AGCCTTTGTGGAGGACAGTGTTGAA C → T GTCAATGGCATCATCCTGGTGACCG
+646
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
160
78
2
0
0.013
160
66
13
1
0.094
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.