UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:GAT1
HGNC Symbol:SLC6A1
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 1
HGNC ID:11042
Superfamily:SLC
Chromosome:Chr.3(+): 11034420-11080935 GRCh37
Location:3p25.3
OMIM:137165
OMIM Phenotype:None
Accessions:X54673
Nucleotide RefSeq:NM_003042
Protein RefSeq:NP_003033
Entrez:6529
Ensembl:ENSG00000157103
Isoforms:3
Evidence:Substrate In Vitro Evidence: GABA in HeLa cells Bennett at al 2000, JBC, Vol 275 (44), p. 34106-13 Several chemical inhibitors of GABA uptake including: cis-3-aminocyclohexane carboxylic acid (ACHC), l-2,4-diamino-N-butyric acid (DABA), nipecotic acid, NO-711, SKF89976A, SKF100330A, and tiagabine Soudijn et al 2000, Curr Med Chem, Vol 7 (10), p. 1063-1079 Substrate In Vivo Evidence: Mice over expressing GAT-1 are an animal model for seizures. The chemical inhibitor ethyl nipecotate inhibited the induced seizures in both GAT-1 overexpressing and control mice Zhao et al 2003, Acta Pharmacol Sin, Vol 24 (10), p. 991-95 Tigabine is a cinically approved antiepileptic drug that is an inhibitor of GAT-1 transport Chen et al 2003, Pflugers Arch GAT-1 expression levels may be associated with schizophrenia Volk et al 2001, Am J Psychiatry, Vol 158 (2), p.256-65 Tissue Distribution Evidence: Neocortex, hippocampus, cerebellum, basal ganglia, spinal cord, olfactory bulb, retina by Northern Hybridization Nelson et al 1990, FEBS Letters, Vol 269 (1), p.181-4 Intracellular Vesicles by confocal microscopy Deken et al 2003, J Neuroscience, Vol 23 (5), p.1563-68
Tissues:nervous system
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA309
HPRD ID:00664
Substrates:GABA
Trivial Names:GAT1, GABATR, GABATHG
Transcripts:NM_003042.3 [Chr.3(+): 11034420-11080935 GRCh37]
XM_005265410.1 [Chr.3(+): 11055428-11080935 GRCh37]
XM_005265411.1 [Chr.3(+): 11055428-11080935 GRCh37]
ENST00000287766 [Chr.3(+): 11034410-11080933 GRCh37]
ENST00000425938 [Chr.3(+): 11034414-11059013 GRCh37]
ENST00000460480 [Chr.3(+): 11058802-11064123 GRCh37]
ENST00000462473 [Chr.3(+): 11034420-11059562 GRCh37]
ENST00000495636 [Chr.3(+): 11074923-11078964 GRCh37]
ENST00000536032 [Chr.3(+): 11058802-11078834 GRCh37]
Annotation History:View Events (18)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A1.

Variant Data

View all PMT variants for SLC6A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 3: CodingPDE
11058903 GRCh37
11033903 NCBI36
4176
CTGCGTCCAAATTCCGAGACATGGC G → A ACCAACGGCAGCAAGGTGGCCGACG
+2
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE
11060297 GRCh37
11035297 NCBI36
795384
TTCCGCTCCCAGGCGTGGGCCTTGC G → A GCTGCTGTGCTATCATTCTGGCTGA
+128
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11060430 GRCh37
11035430 NCBI36
  
CCCCATCCAGCAGAAGCCACACCCA G → C AGCCCACCCTTGGCCCACCACGGCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
98
2
0
0.010
200
100
0
0
0.000
60
29
0
1
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 6: CodingPDE
11061962 GRCh37
11036962 NCBI36
946535
AGACCGCTGCTTCTCCAACTACAGC A → G TGGTCAACACTACCAACATGACCAG
+179
Met → Val
(D=21)
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11064204 GRCh37
11039204 NCBI36
  
GGACAGGAGGGCACTGGATAGAGGA A → T CAGGTCTACAAAGGAAGCTCTGCCC
+ 
 
n=
A/A=
A/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE
11067200 GRCh37
11042200 NCBI36
1191780
TCATCCTGTTCTTCCGTGGAGTGAC G → A CTGCCCGGGGCCAAGGAGGGCATCC
+260
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
200
88
12
0
0.060
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11067289 GRCh37
11042289 NCBI36
  
TCCGAGGTGAGTGCCCCTCCCAGCC C → T GGATTCTGAGCCACCACTTAGCAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11067341 GRCh37
11042341 NCBI36
  
TTGAGATAAGCTTTTGCATCTTTCT G → A ACCCTCACTGTAGACCAGGTTTGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
98
2
0
0.010
200
96
4
0
0.020
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 9: CodingPDE
11067521 GRCh37
11042521 NCBI36
1323912
ACGGGCTGGGCCTGGGGTCCCTGAT C → T GCTCTCGGGAGCTACAACTCTTTCC
+304
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11067583 GRCh37
11042583 NCBI36
  
TACAGGTTTGAGAGGACAGCTGCGG G → T AGCCCCTTCCTTCCTGGCCGAGCCC
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 10: CodingPDE
11067927 GRCh37
11042927 NCBI36
1371960
CACCCCTCCCTCTCTTCAGGGACTC C → T ATCATCGTCTGCTGCATCAATTCGT
+320
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
200
96
4
0
0.020
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11070550 GRCh37
11045550 NCBI36
  

C → CC, -, CCC
GACAGCCAGGTGAGGGCGCCCCCCC C → - GCACCCCAGGAGCTCTCCATCCCCA
GACAGCCAGGTGAGGGCGCCCCCCC C → CC GCACCCCAGGAGCTCTCCATCCCCA
GACAGCCAGGTGAGGGCGCCCCCCC C → CCC GCACCCCAGGAGCTCTCCATCCCCA
+ 

 
 
 
 
n=
C/C=
C/-=
-/-=
C/CC=
CC/CC=
C/CCC=
CCC/CCC=
-/CC=
-/CCC=
CC/CCC=
-=
CC=
CCC=
200
24
41
18
9
0
1
0
7
0
0
0.420
0.080
0.005
200
93
7
0
0
0
0
0
0
0
0
0.035
0.000
0.000
60
12
13
5
0
0
0
0
0
0
0
0.383
0.000
0.000
20
8
0
1
1
0
0
0
0
0
0
0.100
0.050
0.000
14
2
5
0
0
0
0
0
0
0
0
0.357
0.000
0.000
Set-I
 PDE
11070864 GRCh37
11045864 NCBI36
  
AGGGCCAGGCTTTGGGTGGGTTGGG G → T CTGGGGCTGCTGCAGGTGGCTGACC
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
86
14
0
0.070
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11070870 GRCh37
11045870 NCBI36
  
AGGCTTTGGGTGGGTTGGGGCTGGG G → A CTGCTGCAGGTGGCTGACCTCTGTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11070877 GRCh37
11045877 NCBI36
  
GGGTGGGTTGGGGCTGGGGCTGCTG C → T AGGTGGCTGACCTCTGTTCCCACCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 12: CodingPDE
11070990 GRCh37
11045990 NCBI36
16861275
GCAACCGCAGAGAGCTCTTCATTGC T → G GCTGTCTGCATCATCTCCTACCTGA
+425
Ala = Ala
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 14: CodingPDE
11075425 GRCh37
11050425 NCBI36
19381527
CTTTCTTCACACCAATCATTGTGGC G → A GTAAGAACAAGGCCTGACTAGCCCT
+509
Ala = Ala
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 15: CodingPDE
11076336 GRCh37
11051336 NCBI36
20581647
CTCTGTCTTCCATGGTCCTCATCCC C → T GGGTACATGGCCTACATGTTCCTCA
+549
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
200
100
0
0
0.000
200
100
0
0
0.000
60
28
2
0
0.033
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
11076400 GRCh37
11051400 NCBI36
  
CCTGAAGCAGGTAAGCCCTTCCCCA C → G CCTTCAAATTGCCAGTGCCCTTCTC
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
96
4
0
0.020
200
75
24
1
0.130
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.