UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:BGT1
HGNC Symbol:SLC6A12
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 12
HGNC ID:11045
Superfamily:SLC
Chromosome:Chr.12(-): 299243-323740 GRCh37
Location:12p13
OMIM:603080
OMIM Phenotype:None
Accessions:U27699
Nucleotide RefSeq:NM_003044
Protein RefSeq:NP_003035
Entrez:6539
Ensembl:ENSG00000111181
Isoforms:9
Evidence:Substrate In Vitro Evidence: GABA in transfected cells Rasola et al 1995, FEBS Letters, Vol 373 (3), p.229-233 Betaine Chen et al 2003, Pflugers Arch Chemical Inhibitors (in vitro) Phloretin, L-2,4-diaminobutyric acid, and hypotaurine (IC50 values of approximately 150-400 microM) Borden et al 1995, J Neurochem, Vol 64 (3) p.977-84 Tissue Distribution Evidence: Kidney, brain, liver, heart, skeletal muscle, placenta by Northern Blot analysis Rasola et al 1995, FEBS Letters, Vol 373 (3), p.229-233
Tissues:Kidney, brain, liver, heart, skeletal muscle, placenta
Type:protein-coding
Sets:0
PharmGKB ID:PA35908
HPRD ID:04358
Substrates:betaine, GABA
Trivial Names:BGT1, GAT2, BGT-1
Transcripts:NM_003044.4 [Chr.12(-): 299243-322613 GRCh37]
NM_001122847.2 [Chr.12(-): 299243-322863 GRCh37]
NM_001122848.2 [Chr.12(-): 299243-323371 GRCh37]
NM_001206931.1 [Chr.12(-): 299243-323371 GRCh37]
XM_005253744.1 [Chr.12(-): 299247-323740 GRCh37]
XM_005253746.1 [Chr.12(-): 299247-320382 GRCh37]
XM_005253745.1 [Chr.12(-): 299247-319685 GRCh37]
XM_005253747.1 [Chr.12(-): 300738-323351 GRCh37]
XM_005253748.1 [Chr.12(-): 301029-323351 GRCh37]
ENST00000359674 [Chr.12(-): 299243-322863 GRCh37]
ENST00000397296 [Chr.12(-): 299252-319771 GRCh37]
ENST00000424061 [Chr.12(-): 299302-322504 GRCh37]
ENST00000428720 [Chr.12(-): 299252-323689 GRCh37]
ENST00000535347 [Chr.12(-): 312035-323256 GRCh37]
ENST00000535498 [Chr.12(-): 305400-308937 GRCh37]
ENST00000536116 [Chr.12(-): 311906-322711 GRCh37]
ENST00000536824 [Chr.12(-): 300234-323286 GRCh37]
ENST00000537793 [Chr.12(-): 311958-320382 GRCh37]
ENST00000537826 [Chr.12(-): 318862-323736 GRCh37]
ENST00000538272 [Chr.12(-): 307077-312673 GRCh37]
ENST00000538424 [Chr.12(-): 321238-322883 GRCh37]
ENST00000538580 [Chr.12(-): 310394-311948 GRCh37]
ENST00000540094 [Chr.12(-): 307837-311980 GRCh37]
ENST00000542825 [Chr.12(-): 304392-308220 GRCh37]
ENST00000544782 [Chr.12(-): 305996-308226 GRCh37]
ENST00000545058 [Chr.12(-): 299252-308224 GRCh37]
Annotation History:View Events (47)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A12.

Variant Data

View all PMT variants for SLC6A12 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A12 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A12 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
322973 GRCh37
193234 NCBI36
-360-3821
GAGGTTATTGCAGGTCCTGCCCCCC G → A CTGCAGACACGCAGTTCCACAGAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
132
66
0
0
0.000
116
58
0
0
0.000
128
63
1
0
0.008
PMT-272
PromoterPDE
322726 GRCh37
192987 NCBI36
-113-3574
GGGCCCTCGGGAATGCCCCGAGGTT T → C CTCCTGTCCACTTCTCCTTCCACCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
38
23
4
0.238
134
61
6
0
0.045
128
63
1
0
0.008
130
58
7
0
0.054
PMT-272
PromoterPDE
322722 GRCh37
192983 NCBI36
-109-3570
TCCTGGGCCCTCGGGAATGCCCCGA G → C GTTTCTCCTGTCCACTTCTCCTTCC
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
134
64
3
0
0.022
128
64
0
0
0.000
130
60
5
0
0.038
PMT-272
PromoterPDE
322720 GRCh37
192981 NCBI36
-107-3568
GTTCCTGGGCCCTCGGGAATGCCCC G → C AGGTTTCTCCTGTCCACTTCTCCTT
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
57
7
1
0.069
134
67
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
322637 GRCh37
192898 NCBI36
-24-3485
CTGGGAGGCGCCTGGCACCCAGCTC G → A TCACGCTCAGCCGGCAGGCAGCGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
134
61
6
0
0.045
128
64
0
0
0.000
130
59
6
0
0.046
PMT-272
PromoterPDE
322618 GRCh37
192879 NCBI36
-5-3466
AAGCCAAGACAGCTTCCTCCTGGGA G → A GCGCCTGGCACCCAGCTCGTCACGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
134
67
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
322588 GRCh37
192849 NCBI36
26-3436
TACAAGCACACCCATAGCATCCACC G → A CCCAAAGCCAAGACAGCTTCCTCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
134
67
0
0
0.000
128
64
0
0
0.000
130
62
3
0
0.023
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.