UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SLC6A14
HGNC Symbol:SLC6A14
HGNC Description:solute carrier family 6 (amino acid transporter), member 14
HGNC ID:11047
Superfamily:SLC
Chromosome:Chr.X(+): 115567747-115592625 GRCh37
Location:Xq23
OMIM:300444
OMIM Phenotype:None
Accessions:NM_007231
Nucleotide RefSeq:NM_007231
Protein RefSeq:NP_009162
Entrez:11254
Ensembl:ENSG00000087916
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:V
PharmGKB ID:PA35910
HPRD ID:02344
Substrates:None
Trivial Names:BMIQ11
Transcripts:NM_007231.3 [Chr.X(+): 115567747-115592625 GRCh37]
ENST00000371900 [Chr.X(+): 115567790-115592625 GRCh37]
ENST00000463626 [Chr.X(+): 115586143-115590108 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A14.

Variant Data

View all PMT variants for SLC6A14 on UCSC Genome Browser
Showing SNP features for transcript: NM_007231  
SLC6A14 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A14 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
115567492 GRCh37
115481520 NCBI36
-255-386
CCCAGAACAGAGACCAGACTGAGAG A → G CGAGGTTAGGAGGAAACAGGGGACC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
38
16
12
0.303
128
57
5
2
0.070
136
66
2
0
0.015
132
58
6
2
0.076
PMT-272
PromoterPDE
115567509 GRCh37
115481537 NCBI36
-238-369
ACTGAGAGACGAGGTTAGGAGGAAA C → A AGGGGACCCAGGAAAGGCGGCTAGA
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
63
3
0
0.023
128
64
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
115567527 GRCh37
115481555 NCBI36
-220-351
GAGGAAACAGGGGACCCAGGAAAGG C → T GGCTAGATTGCAAACGTACCTACAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
128
64
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.