UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:V7-3
HGNC Symbol:SLC6A15
HGNC Description:solute carrier family 6 (neutral amino acid transporter), member 15
HGNC ID:13621
Superfamily:SLC
Chromosome:Chr.12(-): 85253267-85306608 GRCh37
Location:12q21.3
OMIM:607971
OMIM Phenotype:None
Accessions:AK022853,BC070040
Nucleotide RefSeq:NM_018057
Protein RefSeq:NP_060527
Entrez:55117
Ensembl:ENSG00000072041
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA37799
HPRD ID:12141
Substrates:None
Trivial Names:V7-3, NTT73, SBAT1, hv7-3
Transcripts:NM_018057.6 [Chr.12(-): 85274627-85306608 GRCh37]
NM_182767.5 [Chr.12(-): 85253267-85306608 GRCh37]
NM_001146335.2 [Chr.12(-): 85253267-85306608 GRCh37]
ENST00000266682 [Chr.12(-): 85254102-85306655 GRCh37]
ENST00000309283 [Chr.12(-): 85253492-85267109 GRCh37]
ENST00000450363 [Chr.12(-): 85274624-85306572 GRCh37]
ENST00000547240 [Chr.12(-): 85277777-85306600 GRCh37]
ENST00000548267 [Chr.12(-): 85255382-85261612 GRCh37]
ENST00000549540 [Chr.12(-): 85285612-85305803 GRCh37]
ENST00000551010 [Chr.12(-): 85285841-85307394 GRCh37]
ENST00000551388 [Chr.12(-): 85266866-85306604 GRCh37]
ENST00000551612 [Chr.12(-): 85266908-85306572 GRCh37]
ENST00000551818 [Chr.12(-): 85264341-85268307 GRCh37]
ENST00000552192 [Chr.12(-): 85255373-85306580 GRCh37]
Annotation History:View Events (15)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A15.

Variant Data

View all PMT variants for SLC6A15 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A15 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A15 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
85307038 GRCh37
83831169 NCBI36
-430-21139
AGTCAGTAATGGGACTAGAAAAAAT G → C GGTGACCCAAAGAACCCTTTTCCCT
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
85307015 GRCh37
83831146 NCBI36
-407-21116
GCACCATCTGAATATTCTCCAAGAG T → C CAGTAATGGGACTAGAAAAAATGGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
45
19
1
0.162
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
85306782 GRCh37
83830913 NCBI36
-174-20883
AAAACCCATTGATGCAGCGGCCACT G → A CGGCTGCCGAGCGGCGTCTTCCCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
85306765 GRCh37
83830896 NCBI36
-157-20866
CCGCACCTCCCTGCCCCAAAACCCA T → C TGATGCAGCGGCCACTGCGGCTGCC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
39
25
1
0.208
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
85306697 GRCh37
83830828 NCBI36
-89-20798
CAGAGGAGAAGGGTAGGCTGTGGGC G → C GCGGCGGGGCGCGGAGGGGTAGCCA
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
64
1
0
0.008
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
85306637 GRCh37
83830768 NCBI36
-29-20738
AGGGTGTGACGGAGGCGCCCACGTG C → T TCGGCCCGCCCGTGTTACGGCCGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
45
19
1
0.162
128
64
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction: TOPO2 image is not available.