UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NTT5
HGNC Symbol:SLC6A16
HGNC Description:solute carrier family 6, member 16
HGNC ID:13622
Superfamily:SLC
Chromosome:Chr.19(-): 49792889-49828521 GRCh37
Location:19q13.33
OMIM:607972
OMIM Phenotype:None
Accessions:AL136856,AW451672,BG772801
Nucleotide RefSeq:NM_014037
Protein RefSeq:NP_054756
Entrez:28968
Ensembl:ENSG00000063127
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA37800
HPRD ID:
Substrates:None
Trivial Names:NT5, NTT5
Transcripts:NM_014037.2 [Chr.19(-): 49792889-49828474 GRCh37]
XM_005258819.1 [Chr.19(-): 49792889-49828521 GRCh37]
XM_005258820.1 [Chr.19(-): 49792889-49828478 GRCh37]
ENST00000335875 [Chr.19(-): 49792895-49828482 GRCh37]
ENST00000454748 [Chr.19(-): 49793022-49828442 GRCh37]
ENST00000594180 [Chr.19(-): 49809014-49812209 GRCh37]
ENST00000594917 [Chr.19(-): 49809342-49813668 GRCh37]
ENST00000597969 [Chr.19(-): 49809142-49813403 GRCh37]
ENST00000598221 [Chr.19(-): 49796407-49828389 GRCh37]
ENST00000598828 [Chr.19(-): 49793948-49828472 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A16.

Variant Data

View all PMT variants for SLC6A16 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A16 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A16 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
49828912 GRCh37
54520724 NCBI36
-438-14308
GGCTGCAGACAAGAATTAAAAACTC A → C AAGATTTACTTAGGTCATCCGTTCT
+ 
 
n=
A/A=
A/C=
C/C=
C=
128
57
6
1
0.063
134
66
1
0
0.007
130
65
0
0
0.000
132
63
3
0
0.023
PMT-272
 PDEI
49828897 GRCh37
54520709 NCBI36
-423-14293
TCAGAAGCCTACTAGGGCTGCAGAC A → G AGAATTAAAAACTCAAAGATTTACT
+ 
 
n=
A/A=
A/G=
G/G=
G=
128
25
27
12
0.398
134
43
19
5
0.216
130
31
24
10
0.338
132
43
23
0
0.174
PMT-272
 PDEI
49828855 GRCh37
54520667 NCBI36
-381-14251
ATGCGTCCAACAAGGCAGACAGGGA C → T GTTGCCTTAAGAGAGCTCAGAAGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
26
26
12
0.391
134
43
19
5
0.216
132
31
24
11
0.348
132
43
23
0
0.174
PMT-272
 PDE
49828774 GRCh37
54520586 NCBI36
-300-14170
GAATCGTCTCATTCATTCCTTCTAG C → T CTTCAAACCTTTCGCATTTACTTAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
50
15
0
0.115
134
60
7
0
0.052
132
44
18
4
0.197
132
62
4
0
0.030
PMT-272
 PDE
49828746 GRCh37
54520558 NCBI36
-272-14142
GTAAGGAAGAAGAGGGTAGGAAGTG G → A GAGAATCGTCTCATTCATTCCTTCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
49828491 GRCh37
54520303 NCBI36
-17-13887
TCCCGCCGATTCTCTGCGCATGCGC C → G GCCGCGCCCCCTCACTCTTTCCCTA
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
64
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
49828482 GRCh37
54520294 NCBI36
-8-13878
CGCGGCCTTTCCCGCCGATTCTCTG C → T GCATGCGCCGCCGCGCCCCCTCACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.