UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SLC6A17
HGNC Symbol:SLC6A17
HGNC Description:solute carrier family 6 (neutral amino acid transporter), member 17
HGNC ID:31399
Superfamily:SLC
Chromosome:Chr.1(+): 110693132-110744824 GRCh37
Location:1p13.3
OMIM:610299
OMIM Phenotype:None
Accessions:AL355990
Nucleotide RefSeq:NM_001010898
Protein RefSeq:NP_001010898
Entrez:388662
Ensembl:ENSG00000197106
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134941636
HPRD ID:18061
Substrates:None
Trivial Names:NTT4
Transcripts:NM_001010898.2 [Chr.1(+): 110693132-110744824 GRCh37]
ENST00000331565 [Chr.1(+): 110693108-110744824 GRCh37]
ENST00000465159 [Chr.1(+): 110735190-110737610 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A17.

Variant Data

View all PMT variants for SLC6A17 on UCSC Genome Browser
Showing SNP features for transcript: NM_001010898  
SLC6A17 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A17 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
110692887 GRCh37
110494410 NCBI36
-245-16665
TCCAGGAGGGCTTTAACCATTGGGG C → G CCCATTCCTCTCCGAGGGCAGAAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
62
3
0
0.023
134
67
0
0
0.000
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
110692930 GRCh37
110494453 NCBI36
-202-16622
GCAGAAGCCCTGGCGAGGGCTCCAG G → A GTCTGCATCCCCTGACCAGGGGCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
134
67
0
0
0.000
126
63
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
110692931 GRCh37
110494454 NCBI36
-201-16621
CAGAAGCCCTGGCGAGGGCTCCAGG G → A TCTGCATCCCCTGACCAGGGGCCTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
134
67
0
0
0.000
126
63
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
110692983 GRCh37
110494506 NCBI36
-149-16569
AGAAGCTAAGCCCCCTTGCAACTCC C → T TCTCCCGCCCCACGCCCACCCTCTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
64
1
0
0.008
134
67
0
0
0.000
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
110693009 GRCh37
110494532 NCBI36
-123-16543
TCTCCCGCCCCACGCCCACCCTCTC C → T GCCTACGTCGGCCATCAGAGCCTCG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
59
6
0
0.046
134
67
0
0
0.000
126
63
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
110693053 GRCh37
110494576 NCBI36
-79-16499
AGCCTCGCTCGCTGCCCGAGAGCCT C → T GCATTGACGCCGGCCCGCGCGTGAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
134
66
1
0
0.007
126
63
0
0
0.000
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.