UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:Xtrp2
HGNC Symbol:SLC6A18
HGNC Description:solute carrier family 6 (neutral amino acid transporter), member 18
HGNC ID:26441
Superfamily:SLC
Chromosome:Chr.5(+): 1225470-1246304 GRCh37
Location:5p15.33
OMIM:610300
OMIM Phenotype:None
Accessions:AK055798
Nucleotide RefSeq:NM_182632
Protein RefSeq:NP_872438
Entrez:348932
Ensembl:ENSG00000164363
Isoforms:2
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134982449
HPRD ID:15396
Substrates:None
Trivial Names:Xtrp2
Transcripts:NM_182632.2 [Chr.5(+): 1225470-1246304 GRCh37]
XM_005248298.1 [Chr.5(+): 1225497-1246304 GRCh37]
ENST00000296821 [Chr.5(+): 1225470-1244492 GRCh37]
ENST00000324642 [Chr.5(+): 1225470-1246304 GRCh37]
ENST00000513607 [Chr.5(+): 1225524-1232954 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A18.

Variant Data

View all PMT variants for SLC6A18 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A18 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A18 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
1225043 GRCh37
1278043 NCBI36
-427-550

C → T, G
TGTCACCCTGTCCTGCCCAGCGGCC C → G GAGGGCAGCAGTGGGTGTGAGGGCA
TGTCACCCTGTCCTGCCCAGCGGCC C → T GAGGGCAGCAGTGGGTGTGAGGGCA
+ 

 
 
 
n=
C/C=
C/G=
G/G=
C/T=
T/T=
G/T=
G=
T=
124
61
1
0
0
0
0
0.008
0.000
134
64
0
0
3
0
0
0.000
0.022
122
61
0
0
0
0
0
0.000
0.000
132
64
0
0
2
0
0
0.000
0.015
PMT-272
 PDE
1225044 GRCh37
1278044 NCBI36
-426-549
GTCACCCTGTCCTGCCCAGCGGCCC G → A AGGGCAGCAGTGGGTGTGAGGGCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
124
62
0
0
0.000
134
67
0
0
0.000
122
60
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
1225106 GRCh37
1278106 NCBI36
-364-487
CCAAGAGCAGCTGAGAGGATCCCTG C → T GGGAATCCGGGCTTCGGGTGCATGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
134
67
0
0
0.000
122
59
2
0
0.016
132
58
8
0
0.061
PMT-272
 PDEI
1225121 GRCh37
1278121 NCBI36
-349-472
AGGATCCCTGCGGGAATCCGGGCTT C → T GGGTGCATGCGATCTGATCTGAGTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
18
36
8
0.419
134
25
33
9
0.381
122
36
23
2
0.221
132
20
33
13
0.447
PMT-272
PromoterPDE
1225394 GRCh37
1278394 NCBI36
-76-199
GGACGTGGGTGCCAGGGAAGGACCC C → T GGCGTCAGAGCCAGGGCCTGGACCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
10
38
14
0.532
134
16
40
11
0.463
124
10
29
23
0.605
132
13
34
19
0.545
PMT-272
PromoterPDE
1225398 GRCh37
1278398 NCBI36
-72-195
GTGGGTGCCAGGGAAGGACCCCGGC G → A TCAGAGCCAGGGCCTGGACCTGAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
124
59
3
0
0.024
134
67
0
0
0.000
124
62
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDEI
1225434 GRCh37
1278434 NCBI36
-36-159
GGCCTGGACCTGAGTTACCCATTAA T → C GGCACTCCACTGGTTTTCCTTTAAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
41
18
3
0.194
134
36
26
5
0.269
120
21
32
7
0.383
132
38
26
2
0.227
PMT-272
PromoterPDE
1225449 GRCh37
1278449 NCBI36
-21-144
TACCCATTAATGGCACTCCACTGGT T → C TTCCTTTAAAGAAATGAATAAATAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
60
2
0
0.016
134
59
8
0
0.060
120
60
0
0
0.000
132
52
14
0
0.106
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.