UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:HND
HGNC Symbol:SLC6A19
HGNC Description:solute carrier family 6 (neutral amino acid transporter), member 19
HGNC ID:27960
Superfamily:SLC
Chromosome:Chr.5(+): 1201710-1225232 GRCh37
Location:5p15.33
OMIM:608893
OMIM Phenotype:Hartnup disorder
Accessions:AY591756
Nucleotide RefSeq:NM_001003841
Protein RefSeq:NP_001003841
Entrez:340024
Ensembl:ENSG00000174358
Isoforms:2
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134968815
HPRD ID:10596
Substrates:None
Trivial Names:HND, B0AT1
Transcripts:NM_001003841.2 [Chr.5(+): 1201710-1225232 GRCh37]
XM_005248296.1 [Chr.5(+): 1201710-1217019 GRCh37]
ENST00000304460 [Chr.5(+): 1201710-1225232 GRCh37]
ENST00000515652 [Chr.5(+): 1201710-1223385 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A19.

Variant Data

View all PMT variants for SLC6A19 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A19 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A19 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
1201303 GRCh37
1254303 NCBI36
-407-463
CCCGCTGAGTTCCCTCTCCCTGGAC T → A GGGGTGGGGGCTGGGGATGCCTGTG
+ 
 
n=
T/T=
T/A=
A/A=
A=
116
55
3
0
0.026
120
60
0
0
0.000
126
63
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
1201309 GRCh37
1254309 NCBI36
-401-457
GAGTTCCCTCTCCCTGGACTGGGGT G → C GGGGCTGGGGATGCCTGTGCTCCAG
+ 
 
n=
G/G=
G/C=
C/C=
C=
116
58
0
0
0.000
120
60
0
0
0.000
126
62
1
0
0.008
128
64
0
0
0.000
PMT-272
 PDE1 pub
1201315 GRCh37
1254315 NCBI36
-395-451
CCTCTCCCTGGACTGGGGTGGGGGC T → C GGGGATGCCTGTGCTCCAGGGAGCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
116
4
15
39
0.802
122
37
19
5
0.238
126
29
30
4
0.302
128
17
31
16
0.492
PMT-272
 PDE
1201357 GRCh37
1254357 NCBI36
-353-409
CAGGGAGCTGTGGAGAGGCCCACCC G → A GCGTCCTGCAGGTGGGGGTGTGCGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
1201421 GRCh37
1254421 NCBI36
-289-345
CCAGACCGGGGCAGAGCCAGCATCC T → C GTTTGCCTTGGTTCTTTCTCCCCGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
63
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
1201447 GRCh37
1254447 NCBI36
-263-319
GTTTGCCTTGGTTCTTTCTCCCCGG G → A GTGCACCGGCGTTTGTGCGCATTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
1201458 GRCh37
1254458 NCBI36
-252-308
TTCTTTCTCCCCGGGGTGCACCGGC G → A TTTGTGCGCATTTGTGTGTGCGTTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
134
61
6
0
0.045
132
66
0
0
0.000
132
62
4
0
0.030
PMT-272
PromoterPDE
1201464 GRCh37
1254464 NCBI36
-246-302
CTCCCCGGGGTGCACCGGCGTTTGT G → A CGCATTTGTGTGTGCGTTTGTGCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
29
25
9
0.341
134
54
13
0
0.097
132
35
28
3
0.258
132
56
10
0
0.076
PMT-272
PromoterPDE
1201466 GRCh37
1254466 NCBI36
-244-300
CCCCGGGGTGCACCGGCGTTTGTGC G → A CATTTGTGTGTGCGTTTGTGCAGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
1201476 GRCh37
1254476 NCBI36
-234-290
CACCGGCGTTTGTGCGCATTTGTGT G → C TGCGTTTGTGCAGGGGGAGGGGTGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
126
62
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
1201506 GRCh37
1254506 NCBI36
-204-260
TTTGTGCAGGGGGAGGGGTGGCCAG C → T GCCCACGGAGCAGCCTCCGGTTGCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
60
3
0
0.024
134
35
27
5
0.276
132
30
26
10
0.348
132
52
12
2
0.121
PMT-272
PromoterPDE
1201587 GRCh37
1254587 NCBI36
-123-179
GGGCCGGGCGTCTCTGCAGATAAGG C → T ATTAACAGTCCCTCCGCAGACGCAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
1201602 GRCh37
1254602 NCBI36
-108-164
GCAGATAAGGCATTAACAGTCCCTC C → T GCAGACGCACCCTGCAGATCTGCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
132
64
2
0
0.015
PMT-272
PromoterPDE
1201661 GRCh37
1254661 NCBI36
-49-105
CTCCGTTCTGCCCAGGTGCCTGGGG C → T GAGGTGCCAAAGGTTCTCTATAAAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
1201758 GRCh37
1254758 NCBI36
49-8
GCCTGCTGTGTGCGGAGCCGTCCAG C → T GACCACCATGGTGAGGCTCGTGCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
41
20
1
0.177
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.