UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NET
HGNC Symbol:SLC6A2
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 2
HGNC ID:11048
Superfamily:SLC
Chromosome:Chr.16(+): 55689542-55740104 GRCh37
Location:16q12.2
OMIM:163970
OMIM Phenotype:Orthostatic intolerance
Accessions:X91117
Nucleotide RefSeq:NM_001043
Protein RefSeq:NP_001034
Entrez:6530
Ensembl:ENSG00000103546
Isoforms:4
Evidence:Substrate In Vitro Evidence: Noradrenaline in HeLa cells, also transports norepinephrine and dopamine Pacholczyk et al 1991, Nature, Vol 350 (6316), p.350-54 Sympathomimetic amines and amphetamines Chen et al 2003, Pflugers Arch Substrate In Vivo Evidence: Knockout mouse for NET1. The K.O. mice are hypersensitive to cocaine and amphetamines. Xu et al 2000, Nature Neuroscience, Vol 3 (5), p.465-71 Selective inhibitors of NET include nisoxetine and desipramine, and nonselective inhibitors include cocaine analogs, mazindol, and many other antidepressants Olivier et al 2000, Prog Drug Res, Vol 54, p.59-119 Chen et al 2003, Pflugers Arch Tissue Distribution Evidence: Central and Peripheral Nervous System, adrenal gland, placenta (determined mainly in rats using immunolocalization methods) Schroeter et al 2000, J Comp Neurol, Vol 420 (2), p. 211-32 Chen et al 2003, Pflugers Arch
Tissues:nervous system, adrenal gland, placenta
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA310
HPRD ID:01232
Substrates:noradrenaline, norepinephrine, dopamine
Trivial Names:NET, NAT1, NET1, SLC6A5
Transcripts:NM_001043.3 [Chr.16(+): 55690352-55737700 GRCh37]
NM_001172501.1 [Chr.16(+): 55689542-55737700 GRCh37]
NM_001172504.1 [Chr.16(+): 55690556-55740104 GRCh37]
NM_001172502.1 [Chr.16(+): 55705583-55737700 GRCh37]
ENST00000219833 [Chr.16(+): 55690556-55740104 GRCh37]
ENST00000379906 [Chr.16(+): 55690352-55737700 GRCh37]
ENST00000414754 [Chr.16(+): 55690022-55737662 GRCh37]
ENST00000561820 [Chr.16(+): 55690530-55739560 GRCh37]
ENST00000566163 [Chr.16(+): 55690567-55736258 GRCh37]
ENST00000567238 [Chr.16(+): 55705583-55737703 GRCh37]
ENST00000568529 [Chr.16(+): 55689998-55728025 GRCh37]
ENST00000568655 [Chr.16(+): 55690166-55706043 GRCh37]
ENST00000568943 [Chr.16(+): 55689516-55736258 GRCh37]
ENST00000574918 [Chr.16(+): 55734186-55739765 GRCh37]
Annotation History:View Events (5)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A2.

Variant Data

View all PMT variants for SLC6A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A2 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A2 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
55689822 GRCh37
54247323 NCBI36
-530-785
TAGCGCTAACAGGCTCCAGACGGAG C → T GGGCCGGGCGCTGGGTTAATGCAAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
n/a
0.000
PMT-272
 PDE
55689934 GRCh37
54247435 NCBI36
-418-673
ACCAGTCAGCCCGCGCCCTGCCGGC C → A GCCCCGCGCCTCCAGCTCTTCCCCG
+ 
 
n=
C/C=
C/A=
A/A=
A=
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
128
63
1
0
0.008
n/a
0.000
PMT-272
 PDE
55690054 GRCh37
54247555 NCBI36
-298-553
GGTCGGGGGCCGGCAGGGCGCAAGG C → T ACCAGGGATCCCCTCGCCGCCGGAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
61
5
0
0.038
132
66
0
0
0.000
132
66
0
0
0.000
128
64
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
55690261 GRCh37
54247762 NCBI36
-91-346
AGGGGGTCGGCACGCTGCCCTCAGC C → T TCGGTGAGTTCAATCCCAGCCATTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
64
0
0
0.000
124
61
1
0
0.008
128
64
0
0
0.000
130
65
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
55690265 GRCh37
54247766 NCBI36
-87-342
GGTCGGCACGCTGCCCTCAGCCTCG G → A TGAGTTCAATCCCAGCCATTTGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
55690417 GRCh37
54247918 NCBI36
66-190
CTCTGTTTCCAAATTTTTCCAGCGG A → T CGCGCGCCCTTTTCTGGGAACCCTG
+ 
 
n=
A/A=
A/T=
T/T=
T=
128
60
4
0
0.031
124
62
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
n/a
0.000
PMT-272
Exon 1: 5UTRPDE15 pubsI
55690425 GRCh37
54247926 NCBI36
74-182
CCAAATTTTTCCAGCGGACGCGCGC C → T CTTTTCTGGGAACCCTGCGTCCGCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
1
23
40
0.805
124
2
27
33
0.750
128
9
25
30
0.664
130
1
29
35
0.762
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
55690447 GRCh37
54247948 NCBI36
96-160
CGCCCTTTTCTGGGAACCCTGCGTC C → G GCTCAGCGCGCGCTCATCCCAGTGT
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
64
0
0
0.000
124
62
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
n/a
0.000
PMT-272
Exon 1: 5UTRPDE
55690529 GRCh37
54248030 NCBI36
178-78
CAAGTAGGGAGGAACGGCCGGGTAA C → T CACCTCTTTTCCCTTTATCCAAGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: 5UTRPDE
55690547 GRCh37
54248048 NCBI36
196-60
CGGGTAACCACCTCTTTTCCCTTTA T → A CCAAGCAGAGCCTCGGCGTGCCCCC
+ 
 
n=
T/T=
T/A=
A/A=
A=
128
64
0
0
0.000
124
62
0
0
0.000
128
63
1
0
0.008
130
65
0
0
0.000
n/a
0.000
PMT-272
Exon 1: CodingPDE
55690627 GRCh37
54248128 NCBI36
27621
CATCCATGCTTCTGGCGCGGATGAA C → A CCGCAGGTGCAGCCCGAGAACAACG
+7
Asn → Lys
(D=94)
n=
C/C=
C/A=
A/A=
A=
190
95
0
0
0.000
192
95
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 1: CodingPDE
55690723 GRCh37
54248224 NCBI36
372117
CGGAGCTGCTGGTGGTGAAGGAGCG C → T AACGGCGTCCAGTGCCTGCTGGCGC
+39
Arg = Arg
n=
C/C=
C/T=
T/T=
T=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
55690919 GRCh37
54248420 NCBI36
  
CGGGCTGGGAATTTGAATCTGGGAG G → A TCCACTGTCTGCAGCGGTGGCTGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
190
94
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55705838 GRCh37
54263339 NCBI36
  
CTGGGAGACTCCTACCTTACCCCCT G → A TCCCTGCCCAGGCGTTGGCTATGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
99
1
0
0.005
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55706103 GRCh37
54263604 NCBI36
  
AGTTTTATGAGTAAGTCACAGACCC C → T TTGTGCTGGGCCTGTTGAGGCCAGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 4: CodingPDEI
55719149 GRCh37
54276650 NCBI36
994739
GCTCTGTCTGATGGTCGTCGTCATC G → A TCTTGTATTTTAGCCTCTGGAAAGG
+247
Val → Ile
(D=29)
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
55719228 GRCh37
54276729 NCBI36
  
CTGTGTTTCTCTTTCACTTACTTGG G → A TGATCAACCTTGGGGGGTGTGATTA
+ 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
198
98
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 5: CodingPDE1 pub
55725894 GRCh37
54283395 NCBI36
1103848
TTCGTGCTCCTGGTCCATGGCGTCA C → G GCTGCCCGGAGCCTCCAATGGCATC
+283
Thr → Arg
(D=71)
n=
C/C=
C/G=
G/G=
G=
192
95
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDEIA
55725975 GRCh37
54283476 NCBI36
  
TTGAAAGAGGCCACGGTCAGTGCTC G → A GTGACCACCAAGCCTTGGGCCAGGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
192
0
3
93
0.984
192
1
16
79
0.906
60
0
10
20
0.833
20
0
1
9
0.950
14
0
0
7
1.000
Set-I
 PDE
55726047 GRCh37
54283548 NCBI36
  
AAGGTGATGATGGAAAATCTGGTCC C → T AGCTCTGCCACAAATGTGCAGTGTA
+ 
 
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
192
96
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE2 pubs
55726058 GRCh37
54283559 NCBI36
  
GGAAAATCTGGTCCCAGCTCTGCCA C → T AAATGTGCAGTGTAGCCTTGGACAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
192
96
0
0
0.000
192
92
4
0
0.021
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55729143 GRCh37
54286644 NCBI36
  
AGCCAGCCCAGCAGTCAAAACACAG G → C GTTGAGGGTGTCAAGGGACTTGACC
+ 
 
n=
G/G=
G/C=
C/C=
C=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55729149 GRCh37
54286650 NCBI36
  
CCCAGCAGTCAAAACACAGGGTTGA G → T GGTGTCAAGGGACTTGACCTCACTG
+ 
 
n=
G/G=
G/T=
T/T=
T=
200
100
0
0
0.000
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE
55729190 GRCh37
54286691 NCBI36
12781023
GACCTCACTGTGCTTCTTCCCCCAG G → A GATGCCCTGCTGACCAGCAGCATCA
+341
Arg = Arg
n=
G/G=
G/A=
A/A=
A=
200
95
5
0
0.025
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 7: CodingPDE
55729232 GRCh37
54286733 NCBI36
13201065
GCAGCATCAACTGTATCACCAGCTT C → T GTCTCTGGGTTCGCCATCTTCTCCA
+355
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
99
1
0
0.005
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55729353 GRCh37
54286854 NCBI36
  
CCACCTGGGCCCCAGCCCACTGAGG C → T GGGAGCTGAGAAGCCCACCTTATTC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE1 pubI
55730124 GRCh37
54287625 NCBI36
  
GTTTCAGCCATTGATGAGGTCCTTG A → C TGTTTCTTACAGGAGCTGGCCTAGT
+ 
 
n=
A/A=
A/C=
C/C=
C=
200
82
15
3
0.105
200
44
44
12
0.340
60
18
11
1
0.217
20
4
5
1
0.350
14
1
5
1
0.500
Set-I
Exon 9: CodingPDE37 pubsI
55731835 GRCh37
54289336 NCBI36
15421287
TGGGAGGCATGGAGGCTGTCATCAC G → A GGCCTGGCAGATGACTTCCAGGTCC
+429
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
198
80
19
0
0.096
200
46
45
9
0.315
60
14
15
1
0.283
20
4
5
1
0.350
14
6
1
0
0.071
Set-I
 PDE3 pubs
55731946 GRCh37
54289447 NCBI36
  
TGTTCTGCATAACCAAGGTGAGTAG G → A GGCTGGGCTCTGGGTCACCTGGGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
194
79
18
0
0.093
192
45
43
8
0.307
50
12
10
3
0.320
20
4
5
1
0.350
14
6
1
0
0.071
Set-I
 PDE1 pubI
55733589 GRCh37
54291090 NCBI36
  
CTGGTGTGTAGTGTCTGCAGGGAAG T → C CCTGCATGTGGGGAGGGGGCTGTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
200
93
4
3
0.050
200
96
3
1
0.025
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDE
55735795 GRCh37
54293296 NCBI36
20341779
TTCAGAGACTGGCCTATGGCATCAC G → A CCAGAGAACGAGCACCACCTGGTGG
+593
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
198
98
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55735887 GRCh37
54293388 NCBI36
  
ACCCCTGGGGTGGAGATTACAAGGG C → T GGGCCCTGGCTGTTCCCTGCTGTGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE3 pubsI
55735912 GRCh37
54293413 NCBI36
  
CGGGCCCTGGCTGTTCCCTGCTGTG C → T ACTGCCCAAGGCTAGACATCACATC
+ 
 
n=
C/C=
C/T=
T/T=
T=
200
89
9
2
0.065
200
76
17
7
0.155
60
25
2
3
0.133
20
6
1
3
0.350
14
6
1
0
0.071
Set-I
 PDE
55735998 GRCh37
54293499 NCBI36
  
CCCCTTGGAAACATCGGGATGGGGG A → - CAGGGAGGCTCACCTTGAGCCCATG
+ 
 
n=
A/A=
A/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55735999 GRCh37
54293500 NCBI36
  
CCCTTGGAAACATCGGGATGGGGGA C → - AGGGAGGCTCACCTTGAGCCCATGG
+ 
 
n=
C/C=
C/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55736000 GRCh37
54293501 NCBI36
  
CCTTGGAAACATCGGGATGGGGGAC A → - GGGAGGCTCACCTTGAGCCCATGGC
+ 
 
n=
A/A=
A/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55736001 GRCh37
54293502 NCBI36
  
CTTGGAAACATCGGGATGGGGGACA G → - GGAGGCTCACCTTGAGCCCATGGCC
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55736002 GRCh37
54293503 NCBI36
  
TTGGAAACATCGGGATGGGGGACAG G → - GAGGCTCACCTTGAGCCCATGGCCT
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55736003 GRCh37
54293504 NCBI36
  
TGGAAACATCGGGATGGGGGACAGG G → - AGGCTCACCTTGAGCCCATGGCCTC
+ 
 
n=
G/G=
G/-=
-/-=
-=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
55736099 GRCh37
54293600 NCBI36
  
CCTCTGTGACAATTAGGGAATCAAC T → G TGCACGTTCCCTGAGGTCCGTGAAG
+ 
 
n=
T/T=
T/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
55736149 GRCh37
54293650 NCBI36
  
GGAAGGGGGTGTTTTTCTGCCTTCT C → G TCTACCTCCTGCTGCCCCCGCCAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
200
97
3
0
0.015
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.