UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:Xtrp3
HGNC Symbol:SLC6A20
HGNC Description:solute carrier family 6 (proline IMINO transporter), member 20
HGNC ID:30927
Superfamily:SLC
Chromosome:Chr.3(-): 45796941-45838039 GRCh37
Location:3p21.3
OMIM:605616
OMIM Phenotype:None
Accessions:AJ276207
Nucleotide RefSeq:NM_020208
Protein RefSeq:NP_064593
Entrez:54716
Ensembl:ENSG00000163817
Isoforms:3
Evidence:None
Tissues:None
Type:protein-coding
Sets:0
PharmGKB ID:PA134865308
HPRD ID:16128
Substrates:None
Trivial Names:XT3, SIT1, Xtrp3
Transcripts:NM_020208.3 [Chr.3(-): 45796941-45838035 GRCh37]
NM_022405.3 [Chr.3(-): 45796941-45838035 GRCh37]
XM_005265236.1 [Chr.3(-): 45799673-45838039 GRCh37]
ENST00000353278 [Chr.3(-): 45796942-45837962 GRCh37]
ENST00000358525 [Chr.3(-): 45796942-45838027 GRCh37]
ENST00000413781 [Chr.3(-): 45812709-45838027 GRCh37]
ENST00000456124 [Chr.3(-): 45797496-45837975 GRCh37]
ENST00000470226 [Chr.3(-): 45831793-45837852 GRCh37]
ENST00000473146 [Chr.3(-): 45799996-45813831 GRCh37]
ENST00000493980 [Chr.3(-): 45801472-45807262 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A20.

Variant Data

View all PMT variants for SLC6A20 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A20 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A20 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
45838466 GRCh37
45813470 NCBI36
-431-555
TGGTTCAACCTAGCCCACGTATAAG A → G CTGAGAGACGCGAGGAAGACACCTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
76
38
0
0
0.000
78
39
0
0
0.000
70
35
0
0
0.000
86
42
1
0
0.012
PMT-272
 PDE
45838300 GRCh37
45813304 NCBI36
-265-389
ATCGAGCGCCTACTGTGTGCCAGGC G → A TTGTCTGGGGACACGGCTGTGAACC
+ 
 
n=
G/G=
G/A=
A/A=
A=
76
19
14
5
0.316
78
15
12
12
0.462
70
19
4
12
0.400
86
14
15
14
0.500
PMT-272
PromoterPDE
45838123 GRCh37
45813127 NCBI36
-88-212
GCTGGTAAATGGATGACGGCGAGCC C → T CACCCCGCCCGATCGTCGCGGCCGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
76
37
1
0
0.013
78
39
0
0
0.000
70
35
0
0
0.000
86
43
0
0
0.000
PMT-272
PromoterPDE
45838096 GRCh37
45813100 NCBI36
-61-185
TAACGGCGCGCCCGTCCGAGAGGCG A → G GGCTGGTAAATGGATGACGGCGAGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
76
38
0
0
0.000
78
38
1
0
0.013
70
35
0
0
0.000
86
43
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
45838013 GRCh37
45813017 NCBI36
23-102
CGTCCCACCCCGGCTCGGCTTGGGG G → T TGGCCCCGCGCCTCCGCCGCCGACG
+ 
 
n=
G/G=
G/T=
T/T=
T=
76
26
8
4
0.211
78
16
10
13
0.462
70
14
13
8
0.414
86
23
13
7
0.314
PMT-272
Exon 1: 5UTRPDE
45837984 GRCh37
45812988 NCBI36
52-73
CAGTCTCAGTGCGCGGTCGCCAGGC G → A CGCCGTCCCACCCCGGCTCGGCTTG
+ 
 
n=
G/G=
G/A=
A/A=
A=
76
38
0
0
0.000
78
39
0
0
0.000
70
34
1
0
0.014
86
43
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
45837983 GRCh37
45812987 NCBI36
53-72

C → T, G
GCAGTCTCAGTGCGCGGTCGCCAGG C → G GCGCCGTCCCACCCCGGCTCGGCTT
GCAGTCTCAGTGCGCGGTCGCCAGG C → T GCGCCGTCCCACCCCGGCTCGGCTT
+ 

 
 
 
n=
C/C=
C/G=
G/G=
C/T=
T/T=
G/T=
G=
T=
76
36
2
0
0
0
0
0.026
0.000
78
38
0
0
1
0
0
0.000
0.013
70
34
1
0
0
0
0
0.014
0.000
86
42
1
0
0
0
0
0.012
0.000
PMT-272
Exon 1: 5UTRPDE
45837981 GRCh37
45812985 NCBI36
55-70
CGGCAGTCTCAGTGCGCGGTCGCCA G → A GCGCGCCGTCCCACCCCGGCTCGGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
76
38
0
0
0.000
78
38
1
0
0.013
70
35
0
0
0.000
86
43
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.