UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:DAT
HGNC Symbol:SLC6A3
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 3
HGNC ID:11049
Superfamily:SLC
Chromosome:Chr.5(-): 1392905-1445543 GRCh37
Location:5p15.3
OMIM:126455
OMIM Phenotype:None
Accessions:M95167
Nucleotide RefSeq:NM_001044
Protein RefSeq:NP_001035
Entrez:6531
Ensembl:ENSG00000142319
Isoforms:1
Evidence:Substrate In Vitro Evidence: Dopamine in mouse fibroblast Ltk- cells, transport of dopamine inhibited by psychostimulant drugs (cocaine, l- and d-amphetamine, and phenyclidine), neurotoxins (6-hydroxydopamine and N-methyl-4-phenylpyridine (MPP))+), neurotransmitters (epinephrine, norepinephrine, gamma-aminobutyric acid, and serotonin), antidepressants (amitriptyline, bupropion, desipramine, mazindol, nomifensine, and nortriptyline), and various uptake inhibitors (mazindol, GBR 12783, GBR 12909, and amfonelic acid). Giros et al 1992, Mol Pharmacol, Vol 42 (3), p.383-90 Sympathomimetic amines, amphetamines, MPTP Chen et al 2003, Pflugers Arch Substrate In Vivo Evidence: Dopamine uptake by DAT is chemically inhibited by cocaine, methylphenidate, and amphetamines. Gainetdinov et al 2002, Trends Pharmacol Sci, Vol 23, p. 367-373 DAT K.O. mice have disrupted clearance of dopamine, increased extracellular concentrations of dopamine, and are hyperactive with a reduced body size. Cocaine and methylphenidate have no effect on the K.O. mice. Gainetdinov et al 2002, Trends Pharmacol Sci, Vol 23, p. 367-373 DAT is also a potential drug target for Parkinson's disease, Tourette's syndrome, and substance abuse Chen et al 2003, Pflugers Arch Tissue Distribution Evidence: Human Amniotic Epithelial Cells (HAEC) by RT-PCR Elwan et al 2003, Neurosci Lett Vol342 (1-2), p.61-64 Dopaminergic Neurons Chen et al 2003, Pflugers Arch
Tissues:brain (dopaminergic neurons)
Type:protein-coding
Sets:I,IV
PharmGKB ID:PA311
HPRD ID:00543
Substrates:dopamine
Trivial Names:DAT, DAT1, PKDYS
Transcripts:NM_001044.4 [Chr.5(-): 1392905-1445543 GRCh37]
ENST00000270349 [Chr.5(-): 1392909-1445545 GRCh37]
ENST00000453492 [Chr.5(-): 1393785-1443359 GRCh37]
ENST00000511750 [Chr.5(-): 1414856-1416693 GRCh37]
ENST00000512002 [Chr.5(-): 1394144-1401422 GRCh37]
ENST00000513308 [Chr.5(-): 1416143-1443090 GRCh37]
Annotation History:View Events (3)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A3.

Variant Data

View all PMT variants for SLC6A3 on UCSC Genome Browser
Showing SNP features for transcript: NM_001044  
SLC6A3 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A3 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Promoter
1445731 GRCh37
1498731 NCBI36
-188-2419
CCGTGTCCGAGGCTCCGGGACGCGC A → AAC GGACAGTGGAGCCGTGGCCGCCGCT
- 
 
n=
A/A=
A/AAC=
AAC/AAC=
AAC=
114
57
0
0
0.000
134
67
0
0
0.000
124
62
0
0
0.000
102
50
1
0
0.010
n/a
0.000
PMT-272
PromoterPDE
1445689 GRCh37
1498689 NCBI36
-146-2377
GCCGCCGCTTGCTCCCAGCCATCTG C → A GTCCGGGAGGCGGGGGCGGGGGCGC
- 
 
n=
C/C=
C/A=
A/A=
A=
114
56
1
0
0.009
134
67
0
0
0.000
124
62
0
0
0.000
100
50
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
1445657 GRCh37
1498657 NCBI36
-114-2345
GAGGCGGGGGCGGGGGCGCGGCCCG G → C GGAGGTGAGGAGGAGGAGCCAGGAC
- 
 
n=
G/G=
G/C=
C/C=
C=
114
54
3
0
0.026
134
67
0
0
0.000
124
62
0
0
0.000
100
50
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE6 pubs
1445616 GRCh37
1498616 NCBI36
-73-2304
GAGCCAGGACGCGAGGGCGACCCCG T → A CGGCGGGAGGGCGGGGCGGGGCGGA
- 
 
n=
T/T=
T/A=
A/A=
A=
114
22
29
6
0.360
134
9
30
28
0.642
124
37
22
3
0.226
100
15
26
9
0.440
n/a
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
1445526 GRCh37
1498526 NCBI36
18-2214
CCGCCCAGCGCTGCGGAGCGGGAGG G → T GAGGCTTCGCGGAACGCTCTCGGCG
- 
 
n=
G/G=
G/T=
T/T=
T=
114
56
1
0
0.009
134
67
0
0
0.000
124
62
0
0
0.000
100
50
0
0
0.000
n/a
0.000
PMT-272
Exon 2: CodingPDE4 pubsI
1443199 GRCh37
1496199 NCBI36
240114
AGCTCATCCTTGTCAAGGAGCAGAA C → T GGAGTGCAGCTCACCAGCTCCACCC
-38
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
196
90
7
1
0.046
196
87
10
1
0.061
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDE
1443163 GRCh37
1496163 NCBI36
276150
TCACCAGCTCCACCCTCACCAACCC G → T CGGCAGAGCCCCGTGGAGGCCCAGG
-50
Pro = Pro
n=
G/G=
G/T=
T/T=
T=
196
73
23
2
0.138
196
98
0
0
0.000
54
26
1
0
0.019
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 2: CodingPDEI
1443151 GRCh37
1496151 NCBI36
288162
CCCTCACCAACCCGCGGCAGAGCCC C → T GTGGAGGCCCAGGATCGGGAGACCT
-54
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
196
98
0
0
0.000
196
97
1
0
0.005
54
27
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1443007 GRCh37
1496007 NCBI36
  
GTGGCGGTAAGTCCCATCTCAGCCT C → G CCTGAGCATGCTGGCCGGGCGGGGG
- 
 
n=
C/C=
C/G=
G/G=
G=
180
50
28
12
0.289
188
94
0
0
0.000
44
22
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1442987 GRCh37
1495987 NCBI36
  
AGCCTCCCTGAGCATGCTGGCCGGG C → T GGGGGTCGTAGGGGCAGCCGGGGCC
- 
 
n=
C/C=
C/T=
T/T=
T=
180
61
25
4
0.183
188
87
6
1
0.043
44
17
3
2
0.159
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1442979 GRCh37
1495979 NCBI36
  
TGAGCATGCTGGCCGGGCGGGGGTC G → A TAGGGGCAGCCGGGGCCAAGGCACG
- 
 
n=
G/G=
G/A=
A/A=
A=
178
53
31
5
0.230
188
55
32
7
0.245
44
17
2
3
0.182
20
7
3
0
0.150
14
7
0
0
0.000
Set-I
 PDE
1442974 GRCh37
1495974 NCBI36
  
ATGCTGGCCGGGCGGGGGTCGTAGG G → T GCAGCCGGGGCCAAGGCACGTACGG
- 
 
n=
G/G=
G/T=
T/T=
T=
178
23
46
20
0.483
188
15
47
32
0.590
44
17
2
3
0.182
20
5
3
2
0.350
14
5
2
0
0.143
Set-I
 PDE2 pubsI
1432825 GRCh37
1485825 NCBI36
  
ACCTGCGTGGGCTCCATGGCCTCCC C → A CTTCCCGCTAGGTGTGGGCTTCACG
- 
 
n=
C/C=
C/A=
A/A=
A=
198
72
22
5
0.162
194
93
2
2
0.031
60
21
4
5
0.233
18
7
0
2
0.222
14
5
1
1
0.214
Set-I
 PDEI
1432552 GRCh37
1485552 NCBI36
  
TAAGTGGGAGTCGGGTCCTCGGGAA C → T GGGAGAGATGGCGCAGCCAGGTCCC
- 
 
n=
C/C=
C/T=
T/T=
T=
184
78
11
3
0.092
182
91
0
0
0.000
60
29
1
0
0.017
18
9
0
0
0.000
14
6
0
1
0.143
Set-I
 PDE
1432551 GRCh37
1485551 NCBI36
  
AAGTGGGAGTCGGGTCCTCGGGAAC G → A GGAGAGATGGCGCAGCCAGGTCCCC
- 
 
n=
G/G=
G/A=
A/A=
A=
184
92
0
0
0.000
182
91
0
0
0.000
60
29
1
0
0.017
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1432540 GRCh37
1485540 NCBI36
  
GGGTCCTCGGGAACGGGAGAGATGG C → A GCAGCCAGGTCCCCCATGGTAGCCC
- 
 
n=
C/C=
C/A=
A/A=
A=
184
90
1
1
0.016
182
91
0
0
0.000
60
30
0
0
0.000
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1420649 GRCh37
1473649 NCBI36
  
GTCTGCTCACTGCTTCACAGTCCAC A → G GGGGCTCTGGCATTCCCAGGTTTCC
- 
 
n=
A/A=
A/G=
G/G=
G=
200
99
1
0
0.005
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1414948 GRCh37
1467948 NCBI36
  
GCAGCTCAGCTGGTTCCTGAGACGG C → T GTGTCTTGTTCTTACAGGGACGCGA
- 
 
n=
C/C=
C/T=
T/T=
T=
190
95
0
0
0.000
192
95
1
0
0.005
54
26
1
0
0.019
18
9
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 8: CodingPDE
1414819 GRCh37
1467819 NCBI36
12691143
AGAAGCACAGTGTGCCCATCGGGGA C → T GTGGCCAAGGACGGTGAGCCCCTCC
-381
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
192
95
1
0
0.005
194
97
0
0
0.000
58
29
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDEI
1414773 GRCh37
1467773 NCBI36
  
CCTCCTGCTGCACCTGGGCCTGCTC C → T GTGTAGCACCAGCGCCGAGCTCTCA
- 
 
n=
C/C=
C/T=
T/T=
T=
188
80
13
1
0.080
188
94
0
0
0.000
54
26
1
0
0.019
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 9: CodingPDE8 pubsI
1411412 GRCh37
1464412 NCBI36
13411215
CCATCGCCACGCTCCCTCTGTCCTC A → G GCCTGGGCCGTGGTCTTCTTCATCA
-405
Ser = Ser
n=
A/A=
A/G=
G/G=
G=
190
27
57
11
0.416
192
51
38
7
0.271
60
24
6
0
0.100
18
6
2
1
0.222
14
7
0
0
0.000
Set-I
 PDE
1410020 GRCh37
1463020 NCBI36
  
CTGGGTGACAAGTAGGTCTTGGCCC A → G GGCTGCGGTCAGGAGCGCCGCCAGC
- 
 
n=
A/A=
A/G=
G/G=
G=
200
95
5
0
0.025
200
99
1
0
0.005
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
 PDE
1410019 GRCh37
1463019 NCBI36
  
TGGGTGACAAGTAGGTCTTGGCCCA G → A GCTGCGGTCAGGAGCGCCGCCAGCC
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
100
0
0
0.000
60
29
1
0
0.017
20
10
0
0
0.000
14
6
1
0
0.071
Set-I
 PDE
1409985 GRCh37
1462985 NCBI36
  
CAGGAGCGCCGCCAGCCTGCAGCCC G → A ACCCTGTGCTCTGTGTGCAGATGGG
- 
 
n=
G/G=
G/A=
A/A=
A=
200
100
0
0
0.000
200
93
6
1
0.040
60
29
1
0
0.017
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 10: CodingPDEI
1409836 GRCh37
1462836 NCBI36
15241398
TCCTGTCCCTGTTCTGCGTCACCAA C → T GTACGTACCATCGCCGGCTTCGCCT
-466
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
200
100
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: CodingPDE
1409226 GRCh37
1462226 NCBI36
15391413
CTCTCTTCCAGGGTGGCATCTACGT C → G TTCACGCTCCTGGACCATTTTGCAG
-471
Val = Val
n=
C/C=
C/G=
G/G=
G=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 11: CodingPDEI
1409169 GRCh37
1462169 NCBI36
15961470
CGTCCATCCTCTTTGGAGTGCTCAT C → T GAAGCCATCGGAGTGGCCTGGTTCT
-490
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
200
98
2
0
0.010
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE2 pubsI
1409127 GRCh37
1462127 NCBI36
  
CCTGGTTCTATGGTGAGTCCGGGGG A → G AGGCAGCCAAGCCGGCACCCTCTTG
- 
 
n=
A/A=
A/G=
G/G=
G=
200
0
1
99
0.995
198
0
0
99
1.000
60
4
8
18
0.733
20
0
0
10
1.000
14
0
1
6
0.929
Set-I
 PDE
1409114 GRCh37
1462114 NCBI36
  
TGAGTCCGGGGGAAGGCAGCCAAGC C → T GGCACCCTCTTGTTTGGTGGCTGTG
- 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
 PDE
1409109 GRCh37
1462109 NCBI36
  
CCGGGGGAAGGCAGCCAAGCCGGCA C → T CCTCTTGTTTGGTGGCTGTGCCACT
- 
 
n=
C/C=
C/T=
T/T=
T=
200
99
1
0
0.005
198
99
0
0
0.000
60
30
0
0
0.000
20
10
0
0
0.000
14
7
0
0
0.000
Set-I
Exon 13: CodingPDEI
1403073 GRCh37
1456073 NCBI36
18571731
TGGCCATGGTGCCCATCTATGCGGC C → T TACAAGTTCTGCAGCCTGCCTGGGT
-577
Ala = Ala
n=
C/C=
C/T=
T/T=
T=
200
91
9
0
0.045
200
98
2
0
0.010
60
30
0
0
0.000
20
9
1
0
0.050
14
7
0
0
0.000
Set-I
Exon 15: 3UTRPDE1 pubI
1394815 GRCh37
1447815 NCBI36
2024 
AGACGAAGACCCCAGGAAGTCATCC T → C GCAATGGGAGAGACACGAACAAACC
- 
 
n=
T/T=
T/C=
C/C=
C=
186
43
38
12
0.333
174
38
45
4
0.305
58
22
7
0
0.121
12
2
3
1
0.417
14
5
2
0
0.143
Set-I

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.