UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SERT
HGNC Symbol:SLC6A4
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 4
HGNC ID:11050
Superfamily:SLC
Chromosome:Chr.17(-): 28521337-28562986 GRCh37
Location:17q11.2
OMIM:182138
OMIM Phenotype:Long/short promoter polymorphism; Obsessive-compulsive disorder, susceptibility to
Accessions:L05568
Nucleotide RefSeq:NM_001045
Protein RefSeq:NP_001036
Entrez:6532
Ensembl:ENSG00000108576
Isoforms:2
Evidence:Substrate In Vitro Evidence: 5-HT in HeLa cells Ramamoorthy et al 1993, PNAS, Vol 90 (6) p. 2542-6 Uptake of 5-HT by SERT is specifically inhibited by paroxetine, fluoxetine, and imipramine. Cocaine and amphetamines are also non-specific inhibitors (HeLa cells) Ramamoorthy et al 1993, PNAS, Vol 90 (6) p. 2542-6 Substrate In Vivo Evidence: Alterations in SERT activity, binding site density, and gene polymorphisms have been implicated in anxiety, depression, suicide, schizophrenia, autism, substance abuse, and gastrointestinal disorders Lesch and Mossner 1998, Int J of Neuropsychopharmacol, Vol 1 (1), p.87-92 Chen et al 2003, Pfluger's Arch Disruption of 5-HT uptake in SERT knockout mice increases the extracellular concentration of 5-HT sixfold and reduces intracellular concentration by 60-80%. In these mice, the locomotor responses to MDMA are lost while the rewarding properties of cocaine are enhanced Chen et al 2003, Pfluger's Arch Uhl et al 2002, Mol Psychiatry Vol 7 p.21-26 Tissue Distribution Evidence: Central and Peripheral Nervous system, epithelial cells, platlets (mRNA hybridization) Ramamoorthy et al 1993, PNAS, Vol 90 (6) p. 2542-6 Chen et al 2003, Pfluger's Arch
Tissues:nervous system, epithelial cells, platlets
Type:protein-coding
Sets:IV
PharmGKB ID:PA312
HPRD ID:01640
Substrates:serotonin
Trivial Names:HTT, 5HTT, OCD1, SERT, 5-HTT, SERT1, hSERT, 5-HTTLPR
Transcripts:NM_001045.5 [Chr.17(-): 28521337-28562986 GRCh37]
XM_005258025.1 [Chr.17(-): 28521337-28562986 GRCh37]
ENST00000261707 [Chr.17(-): 28523395-28562954 GRCh37]
ENST00000394821 [Chr.17(-): 28525513-28562716 GRCh37]
ENST00000401766 [Chr.17(-): 28521337-28563020 GRCh37]
ENST00000578609 [Chr.17(-): 28525494-28530700 GRCh37]
ENST00000579221 [Chr.17(-): 28524939-28538387 GRCh37]
Annotation History:View Events (17)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A4.

Variant Data

View all PMT variants for SLC6A4 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A4 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A4 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 1: 5UTRPDE3 pubs
28562892 GRCh37
25587018 NCBI36
95-13916
CCCGCCCCGTAGCGCGGCCCCTCCC T → C GGCGAGCGCAACCCCATCCAGCGGG
- 
 
n=
T/T=
T/C=
C/C=
C=
120
49
10
1
0.100
118
51
8
0
0.068
74
35
2
0
0.027
96
42
6
0
0.063
PMT-272
Exon 1: 5UTRPDE
28562879 GRCh37
25587005 NCBI36
108-13903
GCGGCCCCTCCCTGGCGAGCGCAAC C → T CCATCCAGCGGGAGCGCGGAGCCGC
- 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
118
56
3
0
0.025
74
37
0
0
0.000
96
48
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
28562718 GRCh37
25586844 NCBI36
269-13742
AAATACGGCCGCGCCGGCGCCCCTC C → T GCACAGCCAGCGCCGCCGGGTGCCT
- 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
118
58
1
0
0.008
74
37
0
0
0.000
96
47
1
0
0.010
PMT-272
Exon 1: 5UTRPDE
28562711 GRCh37
25586837 NCBI36
276-13735
GCCGCGCCGGCGCCCCTCCGCACAG C → T CAGCGCCGCCGGGTGCCTCGAGGGC
- 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
118
59
0
0
0.000
74
36
1
0
0.014
96
48
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
28562706 GRCh37
25586832 NCBI36
281-13730
GCCGGCGCCCCTCCGCACAGCCAGC G → T CCGCCGGGTGCCTCGAGGGCGCGAG
- 
 
n=
G/G=
G/T=
T/T=
T=
120
60
0
0
0.000
118
58
1
0
0.008
74
36
1
0
0.014
96
48
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
28562696 GRCh37
25586822 NCBI36
291-13720
CTCCGCACAGCCAGCGCCGCCGGGT G → A CCTCGAGGGCGCGAGGCCAGCCCGC
- 
 
n=
G/G=
G/A=
A/A=
A=
120
60
0
0
0.000
118
59
0
0
0.000
74
37
0
0
0.000
96
47
1
0
0.010
PMT-272
Exon 1: 5UTRPDE
28562645 GRCh37
25586771 NCBI36
342-13669
CTGCCCAGCCCGGGACCAGCCTCCC C → T GCGCAGCCTGGCAGGTGGGTCCGCT
- 
 
n=
C/C=
C/T=
T/T=
T=
120
60
0
0
0.000
118
59
0
0
0.000
74
37
0
0
0.000
96
47
1
0
0.010
PMT-272
 PDE
28562611 GRCh37
25586737 NCBI36
 -13635
TGGCAGGTGGGTCCGCTTTTCCTCT C → T CGCCTCGAACCCACGTTTCTTTCCA
- 
 
n=
C/C=
C/T=
T/T=
T=
120
59
1
0
0.008
118
59
0
0
0.000
74
37
0
0
0.000
96
48
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.