UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:GLYT2
HGNC Symbol:SLC6A5
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 5
HGNC ID:11051
Superfamily:SLC
Chromosome:Chr.11(+): 20620946-20676610 GRCh37
Location:11p15.1
OMIM:604159
OMIM Phenotype:None
Accessions:NM_004211
Nucleotide RefSeq:NM_004211
Protein RefSeq:NP_004202
Entrez:9152
Ensembl:ENSG00000165970
Isoforms:2
Evidence:Substrate In Vitro Evidence: Glycine in CHO cells Morrow et al 1998, FEBS Letters, Vol 439, p.334-340 Substrate In Vivo Evidence: Uptake of Glycine by GLYT2 is weakly inhibited by sarcosine Morrow et al 1998, FEBS Letters, Vol 439, p.334-340 Tissue Distribution Evidence: Spinal Cord, Brain (glycinergic neurons) by Northern Blot Chen et al 2003, Pflugers Arch Morrow et al 1998, FEBS Letters, Vol 439, p.334-340
Tissues:brain, spinal cord
Type:protein-coding
Sets:V
PharmGKB ID:PA35911
HPRD ID:08378
Substrates:glycine
Trivial Names:NET1, GLYT2, HKPX3, GLYT-2
Transcripts:NM_004211.3 [Chr.11(+): 20620946-20676610 GRCh37]
XM_005253225.1 [Chr.11(+): 20621140-20676610 GRCh37]
ENST00000298923 [Chr.11(+): 20621140-20676436 GRCh37]
ENST00000525748 [Chr.11(+): 20620946-20680831 GRCh37]
ENST00000528440 [Chr.11(+): 20650730-20676610 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A5.

Variant Data

View all PMT variants for SLC6A5 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A5 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A5 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
20620694 GRCh37
20577270 NCBI36
-252-525
GTGGGGCTATGCGCAGACCCTCAAC C → T TCTTTCGGAGTAATATTTTCGGAAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
132
62
4
0
0.030
132
37
25
4
0.250
132
47
18
1
0.152
PMT-272
PromoterPDE
20620757 GRCh37
20577333 NCBI36
-189-462
GGGGGGACAGCAATGGAATCTAGTG A → G AAGGGAAAGAATAGACAGTGATTTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
65
0
0
0.000
132
66
0
0
0.000
132
63
3
0
0.023
132
66
0
0
0.000
PMT-272
PromoterPDE
20620920 GRCh37
20577496 NCBI36
-26-299
TTCTGTCTTCCCCTCCTGCCGGTTT C → T GGTTTAGTAATCAGACCACATGAGT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
53
11
1
0.100
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
20620980 GRCh37
20577556 NCBI36
35-239
CACGCAGCCCCCTCCCGCTGGAGTG A → G CAACTGGCCAGCATACTCTAGGCTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
65
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
20621027 GRCh37
20577603 NCBI36
82-192
GCTGTTGTCCCTTTAAAACTTGAAT C → T CAAGGGGGTAATGATTTATCAAACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
56
8
1
0.077
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
20621043 GRCh37
20577619 NCBI36
98-176
AACTTGAATCCAAGGGGGTAATGAT T → G TATCAAACTTGTATTATCAAGAAAA
+ 
 
n=
T/T=
T/G=
G/G=
G=
130
47
16
2
0.154
132
53
11
2
0.114
132
66
0
0
0.000
132
59
7
0
0.053
PMT-272
Exon 1: 5UTRPDE
20621081 GRCh37
20577657 NCBI36
136-138
ATTATCAAGAAAATGTCAAACCAAG G → A GCACCTTGCTTTGCACTGACGCAAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.