UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:PROT
HGNC Symbol:SLC6A7
HGNC Description:solute carrier family 6 (neurotransmitter transporter), member 7
HGNC ID:11054
Superfamily:SLC
Chromosome:Chr.5(+): 149569520-149590635 GRCh37
Location:5q32
OMIM:606205
OMIM Phenotype:None
Accessions:AK096607,BM682856,S80071
Nucleotide RefSeq:NM_014228
Protein RefSeq:NP_055043
Entrez:6534
Ensembl:ENSG00000011083
Isoforms:1
Evidence:Substrate In Vitro Evidence: L-proline - Review article. Chen NH, et al. Pflugers Archives. 2003 (Epub). Tissue Distribution Evidence: Brain - Northern Blot. Shafqat S, et al. Mol Pharmacol. 1995 Aug;48(2):219-29.
Tissues:Brain
Type:protein-coding
Sets:0
PharmGKB ID:PA35914
HPRD ID:09371
Substrates:L-Proline
Trivial Names:PROT
Transcripts:NM_014228.3 [Chr.5(+): 149569520-149590635 GRCh37]
ENST00000230671 [Chr.5(+): 149569520-149590635 GRCh37]
ENST00000513403 [Chr.5(+): 149569814-149574767 GRCh37]
ENST00000524041 [Chr.5(+): 149569648-149602351 GRCh37]
Annotation History:View Events (2)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A7.

Variant Data

View all PMT variants for SLC6A7 on UCSC Genome Browser
Showing SNP features for transcript: NM_014228  
SLC6A7 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A7 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
149569152 GRCh37
149549345 NCBI36
-368-739
CTTCCCTGTCCCTCAGCTTCCTCAT C → T TGTAGAATAGGAGTAACGACACCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
57
8
0
0.062
130
56
9
0
0.069
124
62
0
0
0.000
130
60
5
0
0.038
PMT-272
 PDE
149569187 GRCh37
149549380 NCBI36
-333-704
GGAGTAACGACACCTGTCTCTCCAG G → A TTGAGAAAATAGGACACCTAGTTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
130
63
2
0
0.015
124
62
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDE
149569267 GRCh37
149549460 NCBI36
-253-624
ATACTGATAGATTGAATAATTGGAC T → G AATGGTGGCGTGGGCAACCCACAGT
+ 
 
n=
T/T=
T/G=
G/G=
G=
132
66
0
0
0.000
130
65
0
0
0.000
124
62
0
0
0.000
130
64
1
0
0.008
PMT-272
PromoterPDE
149569324 GRCh37
149549517 NCBI36
-196-567
ATAAATGTTAACTGAGCACCTACTA T → A GTGTCAGGCTCTTTGTGCTAGATGT
+ 
 
n=
T/T=
T/A=
A/A=
A=
132
5
23
38
0.750
130
18
30
17
0.492
124
8
30
24
0.629
130
23
35
7
0.377
PMT-272
PromoterPDE
149569362 GRCh37
149549555 NCBI36
-158-529
TTGTGCTAGATGTTTTCTATGCTCC A → G TCTTCCTGAATTGCTCACACTCCTG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
130
65
0
0
0.000
124
62
0
0
0.000
130
61
4
0
0.031
PMT-272
PromoterPDE
149569440 GRCh37
149549633 NCBI36
-80-451
AGGTCGCACAGCAAAGACGACGCAG G → T GGGGTGGGCTGTTAGTGTTCCTTGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
132
61
5
0
0.038
130
63
2
0
0.015
122
50
10
1
0.098
130
63
2
0
0.015
PMT-272
Promoter
Exon 1: 5UTR
PDE
149569550 GRCh37
149549743 NCBI36
31-341
GCCGAGGGTTTCCGTCGCGAACCCC C → G CTCCCCACTCGCTCAGGGCTCTCCA
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
66
0
0
0.000
130
65
0
0
0.000
122
59
2
0
0.016
130
65
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.