UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:GLYT1
HGNC Symbol:SLC6A9
HGNC Description:solute carrier family 6 (neurotransmitter transporter, glycine), member 9
HGNC ID:11056
Superfamily:SLC
Chromosome:Chr.1(-): 44462155-44497171 GRCh37
Location:1p33
OMIM:601019
OMIM Phenotype:None
Accessions:S70612
Nucleotide RefSeq:NM_201649
Protein RefSeq:NP_964012
Entrez:6536
Ensembl:ENSG00000196517
Isoforms:6
Evidence:Substrate In Vitro Evidence: Glycine 1. Xenopus oocytes. Guastella J, et al. PNAS. 1992; 89, 7189-7193. 2. Transfection of COS-7 cells. Kim KM, et al. Mol Pharmacol. 1994 Apr;45(4):608-17. Tissue Distribution Evidence: Five splice variants (GLYT1a-f) with different tissue distributions GLYT1a - brain, pancreas, uterus, stomach, spleen, liver, and lung GLYT1b, GLYT 1c - nervous system GLYT1e, GLYT1f - retina - Review article. Chen NH, et al. Pflugers Archives. 2003 (Epub).
Tissues:GLYT1a: brain, pancreas, uterus, stomach, spleen, liver, and lung. GLYT1b, GLYT 1c: nervous system. GLYT1e, GLYT1f, retina
Type:protein-coding
Sets:0
PharmGKB ID:PA35916
HPRD ID:03010
Substrates:Glycine
Trivial Names:GLYT1
Transcripts:NM_001024845.2 [Chr.1(-): 44462155-44497164 GRCh37]
NM_006934.3 [Chr.1(-): 44462155-44483012 GRCh37]
NM_201649.3 [Chr.1(-): 44462155-44483012 GRCh37]
NM_001261380.1 [Chr.1(-): 44462155-44483012 GRCh37]
XM_005271146.1 [Chr.1(-): 44462160-44497169 GRCh37]
XM_005271145.1 [Chr.1(-): 44462160-44482913 GRCh37]
ENST00000357730 [Chr.1(-): 44463200-44482997 GRCh37]
ENST00000360584 [Chr.1(-): 44463200-44482997 GRCh37]
ENST00000372306 [Chr.1(-): 44457503-44497032 GRCh37]
ENST00000372307 [Chr.1(-): 44457172-44482228 GRCh37]
ENST00000372310 [Chr.1(-): 44462155-44497058 GRCh37]
ENST00000466926 [Chr.1(-): 44476398-44497134 GRCh37]
ENST00000475075 [Chr.1(-): 44463115-44497058 GRCh37]
ENST00000489764 [Chr.1(-): 44475864-44497101 GRCh37]
ENST00000492434 [Chr.1(-): 44474187-44497139 GRCh37]
ENST00000528803 [Chr.1(-): 44474269-44483004 GRCh37]
ENST00000533007 [Chr.1(-): 44480302-44483012 GRCh37]
ENST00000537678 [Chr.1(-): 44466479-44497134 GRCh37]
Annotation History:View Events (38)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC6A9.

Variant Data

View all PMT variants for SLC6A9 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC6A9 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC6A9 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
44483442 GRCh37
44256029 NCBI36
-430-637
GACCATGCAAGAAAGCCCTGGCCTA G → C TGAACCACGCTGTCAGCTGTCTGGA
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
66
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
44483210 GRCh37
44255797 NCBI36
-198-405
AGTTGGGTGTCTGATGAGTGACGGG G → T TCTGCCCCATTGGGCCCTGGATGGT
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
62
5
0
0.037
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
44483138 GRCh37
44255725 NCBI36
-126-333
ACTCCCCCCACGGAGCTGACCAGAC G → A CTGTCTGAGCCCACAGGCCTAGCAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
60
5
1
0.053
PMT-272
PromoterPDE
44483137 GRCh37
44255724 NCBI36
-125-332
CACTCCCCCCACGGAGCTGACCAGA C → T GCTGTCTGAGCCCACAGGCCTAGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
66
1
0
0.007
134
63
4
0
0.030
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
44483121 GRCh37
44255708 NCBI36
-109-316
AGGCGAGAGGGTGGCTCACTCCCCC C → G ACGGAGCTGACCAGACGCTGTCTGA
+ 
 
n=
C/C=
C/G=
G/G=
G=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
44483108 GRCh37
44255695 NCBI36
-96-303
ACTGGGGCAGAGCAGGCGAGAGGGT G → T GCTCACTCCCCCCACGGAGCTGACC
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272

Transmembrane prediction: TOPO2 image is not available.