UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:SLC7A11
HGNC Symbol:SLC7A11
HGNC Description:solute carrier family 7 (anionic amino acid transporter light chain, xc- system), member 11
HGNC ID:11059
Superfamily:SLC
Chromosome:Chr.4(-): 139085248-139163572 GRCh37
Location:4q28-q32
OMIM:607933
OMIM Phenotype:None
Accessions:NM_014331
Nucleotide RefSeq:NM_014331
Protein RefSeq:NP_055146
Entrez:23657
Ensembl:ENSG00000151012
Isoforms:2
Evidence:Substrate In Vitro Evidence: provides cystine for the synthesis of glutathione by exchanging extracellular anionic cystine for intracellular glutamate 1 Xenopus laevis oocytes Tissue Distribution Evidence: brain 1 Northern and RT-PCR
Tissues:brain
Type:protein-coding
Sets:V
PharmGKB ID:PA35919
HPRD ID:09720
Substrates:provides cystine for the synthesis of glutathione by exchanging extracellular anionic cystine for intracellular glutamate
Trivial Names:xCT, CCBR1
Transcripts:NM_014331.3 [Chr.4(-): 139085248-139163503 GRCh37]
XM_005262875.1 [Chr.4(-): 139101862-139163572 GRCh37]
ENST00000280612 [Chr.4(-): 139085251-139163503 GRCh37]
ENST00000509248 [Chr.4(-): 139092998-139144398 GRCh37]
Annotation History:View Events (10)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC7A11.

Variant Data

View all PMT variants for SLC7A11 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC7A11 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC7A11 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
139163885 GRCh37
139383335 NCBI36
-382-662
TGCGTGTATAAAAACATTTTACATG C → T GACTGTTTTGTGAGTAGAATGTATC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
132
63
3
0
0.023
136
67
1
0
0.007
136
67
1
0
0.007
PMT-272
 PDE
139163832 GRCh37
139383282 NCBI36
-329-609
CAAAATGAAACAGGAAATAGTTACT T → C CATTTTAAGGAGTTTCTTTTTCTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
 PDE
139163828 GRCh37
139383278 NCBI36
-325-605
CAAACAAAATGAAACAGGAAATAGT T → A ACTTCATTTTAAGGAGTTTCTTTTT
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
65
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272
PromoterPDE
139163727 GRCh37
139383177 NCBI36
-224-504
GCACACACTTTAAAGAGATTTTAGC C → G AATCCAGAAGTAGTAAATTCGGAAC
+ 
 
n=
C/C=
C/G=
G/G=
G=
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
PMT-272
PromoterPDE
139163639 GRCh37
139383089 NCBI36
-136-416
TCCAGCATTACTCAGCTCTTTTTTT T → A AAAAAAAGAAAAAAACAGGAGGAGC
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
50
15
0
0.115
132
47
17
2
0.159
136
51
16
1
0.132
136
53
14
1
0.118
PMT-272
Exon 1: 5UTR
Promoter
PDE
139163473 GRCh37
139382923 NCBI36
31-250
CTCCTCGTTCCACCACTGCTGCTGC T → C GCTGCTGCTGCCGCCCTATCATTAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.