UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:LAT1-7
HGNC Symbol:SLC7A7
HGNC Description:solute carrier family 7 (amino acid transporter light chain, y+L system), member 7
HGNC ID:11065
Superfamily:SLC
Chromosome:Chr.14(-): 23242431-23289020 GRCh37
Location:14q11.2
OMIM:603593
OMIM Phenotype:Lysinuric protein intolerance
Accessions:NM_003982
Nucleotide RefSeq:NM_001126105
Protein RefSeq:NP_001119577
Entrez:9056
Ensembl:ENSG00000155465
Isoforms:2
Evidence:Substrate In Vitro Evidence: When coinjected with 4F2hc cRNA in X. laevis oocytes, y+LAT1 cRNA induced the sodium-dependent uptake of L-leucine and the sodium-independent uptake of L-arginine (Torrents D, Estevez R, Pineda M, Fernandez E, Lloberas J, Shi YB, Zorzano A, Palacin M. Identification and characterization of a membrane protein (y+L amino acid transporter-1) that associates with 4F2hc to encode the amino acid transport activity y+L. A candidate gene for lysinuric protein intolerance. J Biol Chem 273(49): 32437- 45, 1998). Substrate In Vivo Evidence: Because the substrate selectivity and transport mechanism of SLC7A7 implies that it is important for reabsorption of cationic amino acids at the basolateral membrane, it has been hypothesized that this gene may be defective in lysinuric protein intolerance (Torrents D, Estevez R, Pineda M, Fernandez E, Lloberas J, Shi YB, Zorzano A, Palacin M. Identification and characterization of a membrane protein (y+L amino acid transporter-1) that associates with 4F2hc to encode the amino acid transport activity y+L. A candidate gene for lysinuric protein intolerance. J Biol Chem 273(49): 32437-45, 1998; Pfeiffer R, Rossier G, Spindler B, Meier C, Kuhn L, Verrey F. Amino acid transport of y+L-type by heterodimers of 4F2hc/CD98 and members of the glycoprotein-associated amino acid transporter family. EMBO J 18(1): 49-57, 1999; Borsani G, Bassi MT, Sperandeo MP, De Grandi A, Buoninconti A, Riboni M, Manzoni M, Incerti B, Pepe A, Andria G, Ballabio A, Sebastio G. SLC7A7, encoding a putative permease-related protein, is mutated in patients with lysinuric protein intolerance. Nat Genet 21(3): 297-301, 1999). However, contrary evidence is available (Dall'Asta V, Bussolati O, Sala R, Rotoli BM, Sebastio G, Sperandeo MP, Andria G, Gazzola GC. Arginine transport through system y(+)L in cultured human fibroblasts: normal phenotype of cells from LPI subjects. Am J Physiol Cell Physiol 279(6): C1829-37, 2000). Tissue Distribution Evidence: By Northern blot analysis, y+LAT1 was shown to be expressed predominantly in kidney, with moderate expression in peripheral blood leukocytes, lung, placenta, spleen, and small intestine (Torrents D, Estevez R, Pineda M, Fernandez E, Lloberas J, Shi YB, Zorzano A, Palacin M. Identification and characterization of a membrane protein (y+L amino acid transporter-1) that associates with 4F2hc to encode the amino acid transport activity y+L. A candidate gene for lysinuric protein intolerance. J Biol Chem 273(49): 32437-45, 1998).
Tissues:Kidney (high); peripheral blood leukocytes, lung, placenta, spleen, small intestine (low)
Type:protein-coding
Sets:II,V
PharmGKB ID:PA35925
HPRD ID:04667
Substrates:L-leucine, L-arginine
Trivial Names:LPI, LAT3, MOP-2, Y+LAT1, y+LAT-1
Transcripts:NM_001126105.2 [Chr.14(-): 23242431-23285107 GRCh37]
NM_001126106.2 [Chr.14(-): 23242431-23289020 GRCh37]
ENST00000285850 [Chr.14(-): 23242431-23289005 GRCh37]
ENST00000397528 [Chr.14(-): 23242499-23285107 GRCh37]
ENST00000397529 [Chr.14(-): 23242462-23289005 GRCh37]
ENST00000397532 [Chr.14(-): 23242434-23285012 GRCh37]
ENST00000488800 [Chr.14(-): 23282184-23299029 GRCh37]
ENST00000553351 [Chr.14(-): 23282627-23292653 GRCh37]
ENST00000553632 [Chr.14(-): 23284532-23290069 GRCh37]
ENST00000553874 [Chr.14(-): 23282613-23292645 GRCh37]
ENST00000554061 [Chr.14(-): 23242525-23249684 GRCh37]
ENST00000554517 [Chr.14(-): 23242782-23288930 GRCh37]
ENST00000554741 [Chr.14(-): 23282476-23292620 GRCh37]
ENST00000554758 [Chr.14(-): 23282114-23285085 GRCh37]
ENST00000555251 [Chr.14(-): 23282241-23284391 GRCh37]
ENST00000555678 [Chr.14(-): 23242782-23245008 GRCh37]
ENST00000555702 [Chr.14(-): 23242431-23289020 GRCh37]
ENST00000555911 [Chr.14(-): 23282264-23284732 GRCh37]
ENST00000555959 [Chr.14(-): 23282517-23284676 GRCh37]
ENST00000556287 [Chr.14(-): 23242434-23285686 GRCh37]
ENST00000556350 [Chr.14(-): 23242844-23245441 GRCh37]
ENST00000557129 [Chr.14(-): 23282288-23285408 GRCh37]
ENST00000557629 [Chr.14(-): 23282258-23292172 GRCh37]
Annotation History:View Events (20)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC7A7.

Variant Data

View all PMT variants for SLC7A7 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC7A7 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC7A7 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 3: CodingPDE
23282512 GRCh37
22352352 NCBI36
33896
CCAGCCCAGGGCCGGAGCAGGTGAA G → A CTGAAGAAGGAGATCTCACTGCTTA
-32
Lys = Lys
n=
G/G=
G/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE1 pubI
23282449 GRCh37
22352289 NCBI36
401159
TGATTGTGGGGAACATGATCGGCTC A → G GGCATCTTTGTTTCCCCCAAGGGTG
-53
Ser = Ser
n=
A/A=
A/G=
G/G=
G=
160
12
42
26
0.588
160
31
39
10
0.369
120
42
16
2
0.167
100
29
17
4
0.250
12
2
4
0
0.333
Set-II
Exon 3: CodingPDEI
23282336 GRCh37
22352176 NCBI36
514272
TCCGTCTTTGGGGCCCTTTGTTATG C → T GGAACTGGGCACCACCATTAAGAAA
-91
Ala → Val
(D=64)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
78
2
0
0.013
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDEI
23282152 GRCh37
22351992 NCBI36
698456
TACAGCCTCTCTTCCCGAGCTGCTT C → T GCCCCTTATGCTGCCAGCCGCCTGC
-152
Phe = Phe
n=
C/C=
C/T=
T/T=
T=
160
67
13
0
0.081
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE
23282133 GRCh37
22351973 NCBI36
717475
CTGCTTCGCCCCTTATGCTGCCAGC C → T GCCTGCTGGCTGCTGCCTGCATCTG
-159
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
77
3
0
0.019
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 3: CodingPDE
23282110 GRCh37
22351950 NCBI36
740498
GCCGCCTGCTGGCTGCTGCCTGCAT C → T TGTAAGTGGGGCTGGGGTAGGAGGT
-166
Ile = Ile
n=
C/C=
C/T=
T/T=
T=
160
12
42
26
0.588
160
28
38
14
0.412
120
42
16
2
0.167
100
26
20
4
0.280
12
2
4
0
0.333
Set-II
 PDEI
23249347 GRCh37
22319187 NCBI36
  
TTTGGCTGAAGGGTATATATATCTT G → A GTGACTGGTACTGGAAAAATTGCTT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEA
23249327 GRCh37
22319167 NCBI36
  
ATCTTGGTGACTGGTACTGGAAAAA T → C TGCTTGGGAGTCTAAGGCCCTAGGG
- 
 
n=
T/T=
T/C=
C/C=
C=
160
74
6
0
0.037
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEIA
23249292 GRCh37
22319132 NCBI36
  
GTCTAAGGCCCTAGGGTGGTAAGGG T → C AAGTCACCAATCAGTATTATTTTTC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
72
8
0
0.050
160
51
25
4
0.206
120
24
27
9
0.375
100
26
23
1
0.250
12
2
4
0
0.333
Set-II
 PDEI
23249082 GRCh37
22318922 NCBI36
  
TCTTTTTTAAGCATTTTCTGTGAGC C → T GCACTCCTCTAAGTGCTCTTTGTGC
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
46
4
0
0.040
12
6
0
0
0.000
Set-II
Exon 5: CodingPDEI
23248112 GRCh37
22317952 NCBI36
902660
CTCATTTTGAGAATTCCTTTGAGGG T → C TCATCATTTGCAGTGGGTGACATTG
-220
Gly = Gly
n=
T/T=
T/C=
C/C=
C=
160
53
23
4
0.194
160
63
17
0
0.106
120
30
20
10
0.333
100
17
25
8
0.410
12
5
1
0
0.083
Set-II
Exon 5: CodingPDEI
23248074 GRCh37
22317914 NCBI36
940698
GTGGGTGACATTGCCCTGGCACTGT A → G CTCAGCTCTGTTCTCCTACTCAGGC
-233
Tyr → Cys
(D=194)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
23247981 GRCh37
22317821 NCBI36
  
GAGAGGTAGGTACTGCACCACCAAC T → G TTCCATAGCAGTGATAGCCATCATT
- 
 
n=
T/T=
T/G=
G/G=
G=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
23245614 GRCh37
22315454 NCBI36
  
CAACAGTCTCCATCCCTGGAAAGAC C → T GGTGTGGCAGGGAGAGTCTAAGGAT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
47
3
0
0.030
12
6
0
0
0.000
Set-II
 PDEI
23245224 GRCh37
22315064 NCBI36
  
AAGAAAGGTTGGAATACCTAATAAG G → A GGAATCTGGGGGCATGCCCATCCAT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDEI
23244744 GRCh37
22314584 NCBI36
12461004
TCCTATCTTACCTAACATAGGCTTT T → C CTTTGTGGGCTCAAGAGAAGGCCAT
-335
Phe → Ser
(D=155)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDEI
23244684 GRCh37
22314524 NCBI36
13061064
GCCATCTGCATGATCCATGTTGAGC G → A GTTCACACCAGTGCCTTCTCTGCTC
-355
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
23244615 GRCh37
22314455 NCBI36
  
AAGGATGAGACTGAAAGCCAGATTG C → T GGGGGAAACTTTAGTAACAGCAGAA
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
23243343 GRCh37
22313183 NCBI36
  
AATCCTGAGTTGTCCACTCCAGTTA T → C GTTTCCTGTGCCCTTAGCTCAGCGT
- 
 
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
23243090 GRCh37
22312930 NCBI36
  
CAGCTATTGCAGAGCTTGGTTTTTG C → A CTTTTTCTGTAAATCCAGCCTCCAA
- 
 
n=
C/C=
C/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDEI
23242980 GRCh37
22312820 NCBI36
  
CACACTGAGTTCCATTCAGTGACAC T → C TGAACTCAGCCCAGCTGACCTCTTC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
65
14
1
0.100
160
51
25
4
0.206
120
45
13
2
0.142
100
40
8
2
0.120
12
4
2
0
0.167
Set-II
Exon 11: CodingPDEI
23242828 GRCh37
22312668 NCBI36
17691527
AGATGCCCAAGCAACGGGATCCCAA G → A TCTAACTAAACACCATCTGGAATCC
-509
Lys = Lys
n=
G/G=
G/A=
A/A=
A=
160
23
41
16
0.456
160
69
10
1
0.075
120
52
7
1
0.075
100
45
5
0
0.050
12
5
1
0
0.083
Set-II

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.