UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:NHE3
HGNC Symbol:SLC9A3
HGNC Description:solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3
HGNC ID:11073
Superfamily:SLC
Chromosome:Chr.5(-): 473298-524549 GRCh37
Location:5p15.3
OMIM:182307
OMIM Phenotype:None
Accessions:NM_004174
Nucleotide RefSeq:NM_004174
Protein RefSeq:NP_004165
Entrez:6550
Ensembl:ENSG00000066230
Isoforms:2
Evidence:Substrate In Vitro Evidence: Maintaining cytoplasmic acid-base balance: Na+ Pflugers H+ Pflugers Li+ Pflugers NH4+ Pflugers Tissue Distribution Evidence: kidney, small intestine, testes, ovary, colon, prostate, thymus, peripheral leukocyte, brain, spleen, placenta 21 Northern
Tissues:kidney, small intestine, testes, ovary, colon, prostate, thymus, peripheral leukocyte, brain, spleen, placenta
Type:protein-coding
Sets:IV
PharmGKB ID:PA316
HPRD ID:01660
Substrates:Na+, H+, Li+, NH4+
Trivial Names:NHE3
Transcripts:NM_004174.2 [Chr.5(-): 473334-524549 GRCh37]
XM_005248354.1 [Chr.5(-): 473298-524547 GRCh37]
ENST00000264938 [Chr.5(-): 473425-524447 GRCh37]
ENST00000507407 [Chr.5(-): 479752-482759 GRCh37]
ENST00000514375 [Chr.5(-): 473476-524445 GRCh37]
Annotation History:View Events (11)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLC9A3.

Variant Data

View all PMT variants for SLC9A3 on UCSC Genome Browser
Showing SNP features for transcript:   
SLC9A3 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLC9A3 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
524785 GRCh37
577785 NCBI36
-236-348
CACGCCCCAGGAAGGCGGCCGCGCA G → A TCCCGGGCTCGCTCTTGCCGCGACC
- 
 
n=
G/G=
G/A=
A/A=
A=
114
57
0
0
0.000
132
66
0
0
0.000
126
61
2
0
0.016
126
63
0
0
0.000
PMT-272
PromoterPDE
524772 GRCh37
577772 NCBI36
-223-335
GGCGGCCGCGCAGTCCCGGGCTCGC T → C CTTGCCGCGACCTCCCGGACCTCCA
- 
 
n=
T/T=
T/C=
C/C=
C=
114
35
19
3
0.219
132
42
22
2
0.197
126
61
2
0
0.016
126
41
21
1
0.183
PMT-272
Promoter
524637 GRCh37
577637 NCBI36
-88-200
GGTGTCTGCGCTCGCGAGTGCGCGG C → T GGGGGCGGGCAGGCTCCGCCCCGGG
- 
 
n=
C/C=
C/T=
T/T=
T=
114
57
0
0
0.000
132
66
0
0
0.000
126
62
1
0
0.008
126
63
0
0
0.000
PMT-272
PromoterPDE
524554 GRCh37
577554 NCBI36
-5-117
CGGCGGGCGGGGATCGGACTGTAGC C → G GGTACCGGCACCGGAGCGCGCCGGG
- 
 
n=
C/C=
C/G=
G/G=
G=
114
46
11
0
0.096
132
57
9
0
0.068
126
22
31
10
0.405
126
49
14
0
0.111
PMT-272
Exon 1: 5UTR
Promoter
524512 GRCh37
577512 NCBI36
38-75
CGCGCCGGGTCCTCGCCGGGTCCCA GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC → - 
- 
 
n=
GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC/GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC=
GCGCCCCCCAGGGCCGACCCGACCCGGCTGCGCGCCCC/-=
-/-=
-=
114
57
0
0
0.000
132
66
0
0
0.000
126
63
0
0
0.000
126
62
1
0
0.008
PMT-272
Exon 1: 5UTR
Promoter
PDE
524500 GRCh37
577500 NCBI36
50-63
TCGCCGGGTCCCAGCCCCGCGCGTC G → A GCCCAGCCCAGCCGGGACCCCCCGC
- 
 
n=
G/G=
G/A=
A/A=
A=
114
52
5
0
0.044
132
66
0
0
0.000
126
63
0
0
0.000
126
63
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
524479 GRCh37
577479 NCBI36
71-42
CGTCGGCCCAGCCCAGCCGGGACCC C → T CCGCGACATGCGCGTCCCAGCCCTG
- 
 
n=
C/C=
C/T=
T/T=
T=
114
57
0
0
0.000
132
66
0
0
0.000
126
62
1
0
0.008
126
63
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.