UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATP1A2
HGNC Symbol:SLCO1A2
HGNC Description:solute carrier organic anion transporter family, member 1A2
HGNC ID:10956
Superfamily:SLC
Chromosome:Chr.12(-): 21417534-21548371 GRCh37
Location:12p12
OMIM:602883
OMIM Phenotype:None
Accessions:NM_021094.1
Nucleotide RefSeq:NM_021094
Protein RefSeq:NP_066580
Entrez:6579
Ensembl:ENSG00000084453
Isoforms:7
Evidence:Substrate In Vitro Evidence: Bile salts: cholate X oocytes [7] glycocholate X oocytes [7] taruocholate X oocytes [7] taurochenodeoxycholate (TCDCA) X oocytes [7] tauroursodeoxycholate (TUDCA) X oocytes [7] Hormones and their conjugates: dehydroepiandrosterone-sulfate (DHEAS) X oocytes [5] estradiol-17?-glucuronide estrone-3-sulfate X oocytes [1] T3 NA [4] rT3 NA [4] T4 NA [4] Eicosanoids: prostaglandine E2 Peptides: BQ-123 NA [4] CRC220 NA [4] deltorphin II X oocytes [3] [D-Pen2,5]-Enkephalin (DPDPE) X oocytes [3] Drugs: chlorambuciltaurocholate X oocytes [6] fexofenadine HeLa cells [2] Gd-B 20790 X oocytes [8] ouabain X oocytes [1] Other organic anions: sulfobromophthalein (BSP) X oocytes [7] Organic cations: APD-ajmalinium X oocytes [9] N-methylquinine X oocytes [9] N-methylquinidine X oocytes [9] rocuronium X oocytes [9] Toxins: microcystin NA [4] Tissue Distribution Evidence: liver, brain, lung, kidney, and testes Northern [7] BBB immunofluorescence staining [3] References: 1. Bossuyt, X., M. Muller, and P.J. Meier, Multispecific amphipathic substrate transport by an organic anion transporter of human liver. J Hepatol, 1996. 25(5): p. 733-8. 2. Cvetkovic, M., et al., OATP and P-glycoprotein transporters mediate the cellular uptake and excretion of fexofenadine. Drug Metab Dispos, 1999. 27(8): p. 866-71. 3. Gao, B., et al., Organic anion-transporting polypeptides mediate transport of opioid peptides across blood-brain barrier. J Pharmacol Exp Ther, 2000. 294(1): p. 73-9. 4. Hagenbuch, B. and P.J. Meier, The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta, 2003. 1609(1): p. 1-18. 5. Kullak-Ublick, G.A., et al., Dehydroepiandrosterone sulfate (DHEAS): identification of a carrier protein in human liver and brain. FEBS Lett, 1998. 424(3): p. 173-6. 6. Kullak-Ublick, G.A., et al., Chlorambucil-taurocholate is transported by bile acid carriers expressed in human hepatocellular carcinomas. Gastroenterology, 1997. 113(4): p. 1295-305. 7. Kullak-Ublick, G.A., et al., Molecular and functional characterization of an organic anion transporting polypeptide cloned from human liver. Gastroenterology, 1995. 109(4): p. 1274-82. 8. Pascolo, L., et al., Molecular mechanisms for the hepatic uptake of magnetic resonance imaging contrast agents. Biochem Biophys Res Commun, 1999. 257(3): p. 746-52. 9. van Montfoort, J.E., et al., Polyspecific organic anion transporting polypeptides mediate hepatic uptake of amphipathic type II organic cations. J Pharmacol Exp Ther, 1999. 291(1): p. 147-52.
Tissues:liver, brain, lung, kidney, and testes
Type:protein-coding
Sets:II,IV
PharmGKB ID:PA328
HPRD ID:09112
Substrates:Cholate, glycocholate, taruocholate, taurochenodeoxycholate, tauroursodeoxycholate, dehydroepiandrosterone-sulfate, estradiol-17b-glucuronide, estrone-3-sulfate, T3, rT3,T4, prostaglandine E2, BQ-123, CRC220, deltorphin II, [D-Pen2,5]-Enkephalin, chlorambuciltaurocholate, fexofenadine, Gd-B 20790, ouabain, sulfobromophthalein, APD-ajmalinium, N-methylquinine, N-methylquinidine, rocuronium, microcystin
Trivial Names:OATP, OATP-A, OATP1A2, SLC21A3
Transcripts:NM_021094.3 [Chr.12(-): 21417534-21487832 GRCh37]
NM_134431.3 [Chr.12(-): 21417534-21548371 GRCh37]
XM_005253476.1 [Chr.12(-): 21417534-21548331 GRCh37]
XM_005253475.1 [Chr.12(-): 21417534-21487847 GRCh37]
XM_005253474.1 [Chr.12(-): 21417534-21487845 GRCh37]
XM_005253477.1 [Chr.12(-): 21420986-21477616 GRCh37]
XM_005253478.1 [Chr.12(-): 21427847-21477589 GRCh37]
ENST00000307378 [Chr.12(-): 21417534-21548371 GRCh37]
ENST00000390670 [Chr.12(-): 21428223-21487605 GRCh37]
ENST00000413682 [Chr.12(-): 21457457-21570950 GRCh37]
ENST00000416627 [Chr.12(-): 21487543-21548331 GRCh37]
ENST00000421287 [Chr.12(-): 21471765-21548331 GRCh37]
ENST00000421294 [Chr.12(-): 21467519-21487847 GRCh37]
ENST00000422327 [Chr.12(-): 21459816-21487841 GRCh37]
ENST00000430803 [Chr.12(-): 21487577-21548331 GRCh37]
ENST00000435179 [Chr.12(-): 21467554-21572518 GRCh37]
ENST00000445053 [Chr.12(-): 21467598-21487829 GRCh37]
ENST00000450590 [Chr.12(-): 21467545-21556591 GRCh37]
ENST00000452078 [Chr.12(-): 21417535-21487832 GRCh37]
ENST00000453443 [Chr.12(-): 21459848-21556597 GRCh37]
ENST00000458504 [Chr.12(-): 21422348-21487834 GRCh37]
ENST00000463718 [Chr.12(-): 21427837-21477670 GRCh37]
ENST00000473830 [Chr.12(-): 21464561-21572528 GRCh37]
ENST00000480394 [Chr.12(-): 21426876-21477615 GRCh37]
ENST00000537524 [Chr.12(-): 21422393-21548195 GRCh37]
ENST00000544020 [Chr.12(-): 21422272-21487605 GRCh37]
ENST00000544290 [Chr.12(-): 21422393-21548195 GRCh37]
Annotation History:View Events (51)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO1A2.

Variant Data

View all PMT variants for SLCO1A2 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO1A2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO1A2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
PromoterPDE
21488075 GRCh37
21379342 NCBI36
-243-494
CAAATAACTTGAAAAGAGAGCCTGG C → T CAAAAAAAGATTTTTGAGCCTTGGT
- 
 
n=
C/C=
C/T=
T/T=
T=
134
64
3
0
0.022
136
66
2
0
0.015
130
65
0
0
0.000
130
54
10
1
0.092
n/a
0.000
PMT-272
Promoter
21488073 GRCh37
21379340 NCBI36
-241-492
AATAACTTGAAAAGAGAGCCTGGCC A → AA AAAAAAGATTTTTGAGCCTTGGTAG
- 
 
n=
A/A=
A/AA=
AA/AA=
AA=
134
64
3
0
0.022
136
66
2
0
0.015
130
65
0
0
0.000
130
53
11
1
0.100
n/a
0.000
PMT-272
PromoterPDE
21488025 GRCh37
21379292 NCBI36
-193-444
TAGGGTTAGTGAAGCAGGTTTTTAG T → C ACAAACACAACTCAAAGTATGTGTG
- 
 
n=
T/T=
T/C=
C/C=
C=
130
59
6
0
0.046
136
64
4
0
0.029
130
65
0
0
0.000
128
59
5
0
0.039
n/a
0.000
PMT-272
PromoterPDE1 pubI
21488004 GRCh37
21379271 NCBI36
-172-423
TTAGTACAAACACAACTCAAAGTAT G → A TGTGTTATTAAAAGTAGCTATTTTC
- 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
136
68
0
0
0.000
130
41
22
2
0.200
128
53
10
1
0.094
n/a
0.000
PMT-272
PromoterPDE
21487840 GRCh37
21379107 NCBI36
-8-259
ACTAAAGAGTCACTAAAGTTATTTG A → G TGTACCTTTTGAAATAGAAAACCAA
- 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
136
68
0
0
0.000
130
65
0
0
0.000
128
64
0
0
0.000
n/a
0.000
PMT-272
PromoterPDE
21487838 GRCh37
21379105 NCBI36
-6-257
TAAAGAGTCACTAAAGTTATTTGAT G → A TACCTTTTGAAATAGAAAACCAACA
- 
 
n=
G/G=
G/A=
A/A=
A=
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
128
63
1
0
0.008
n/a
0.000
PMT-272
Exon 1: 5UTR
21487770 GRCh37
21379037 NCBI36
63-189
ACCATGATTTTCTAATCTGTATTAA A → AA GCGTTCCAGGTATTTTTGTAATGCA
- 
 
n=
A/A=
A/AA=
AA/AA=
AA=
134
12
37
18
0.545
136
29
33
6
0.331
130
30
25
10
0.346
130
43
18
4
0.200
n/a
0.000
PMT-272
Exon 1: CodingPDE4 pubsI
21487544 GRCh37
21378811 NCBI36
28938
GAGAAAAGAATTGAAACCCATAGAA T → C AAGATGTCTTTCCAAGTTGAAGGTA
-13
Ile → Thr
(D=89)
n=
T/T=
T/C=
C/C=
C=
160
76
4
0
0.025
160
55
24
1
0.163
120
60
0
0
0.000
100
45
5
0
0.050
12
6
0
0
0.000
Set-II
Exon 1: CodingPDE1 pub
21487531 GRCh37
21378798 NCBI36
30251
AAACCCATAGAATAAGATGTCTTTC C → T AAGTTGAAGGTATGGAATTTTTGTA
-17
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
21471894 GRCh37
21363161 NCBI36
  
CAGACGGCAAGTATACAATTTAAAA A → C TAATTTTTTCTACGTTTTCTTATAT
- 
 
n=
A/A=
A/C=
C/C=
C=
160
80
0
0
0.000
160
80
0
0
0.000
120
58
2
0
0.017
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
21471891 GRCh37
21363158 NCBI36
  
ACGGCAAGTATACAATTTAAAAATA A → T TTTTTTCTACGTTTTCTTATATTTT
- 
 
n=
A/A=
A/T=
T/T=
T=
160
71
9
0
0.056
160
73
7
0
0.044
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
21471881 GRCh37
21363148 NCBI36
  
TACAATTTAAAAATAATTTTTTCTA C → T GTTTTCTTATATTTTTTTCCTAGAT
- 
 
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 2: CodingPDEI
21471732 GRCh37
21362999 NCBI36
437186
CAACATCTCTAGTTGGATTCATTAA T → C GGAAGCTTTGAGATTGGTAATGAAT
-62
Asn = Asn
n=
T/T=
T/C=
C/C=
C=
160
68
12
0
0.075
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
 PDE
21467666 GRCh37
21358933 NCBI36
  
GTAAATGATTGGGTGAGGCTCTTAA T → G TAAGACTTTGTTCATACTTTTTAAA
- 
 
n=
T/T=
T/G=
G/G=
G=
160
68
11
1
0.081
160
39
35
6
0.294
120
60
0
0
0.000
100
35
15
0
0.150
12
4
2
0
0.167
Set-II
 PDE1 pubI
21467417 GRCh37
21358684 NCBI36
  
ACTTGCAGGAAATGAAGTTGCACTT T → C CCTCTCTAGGAGCAATGCTTTCCAA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
77
3
0
0.019
160
79
1
0
0.006
120
26
25
9
0.358
100
50
0
0
0.000
12
3
2
1
0.333
Set-II
Exon 4: CodingPDE3 pubsIA
21459876 GRCh37
21351143 NCBI36
633382
TTCAGTTTCAGGCAACTTGTCCTCA A → T ACAGTTTCTTGTGTATGGAAAATGG
-128
Asn → Tyr
(D=143)
n=
A/A=
A/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 4: CodingPDE3 pubs
21459854 GRCh37
21351121 NCBI36
655404
TCAAACAGTTTCTTGTGTATGGAAA A → T TGGAACCCAGATTTTAAGACCAACG
-135
Asn → Ile
(D=149)
n=
A/A=
A/T=
T/T=
T=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE2 pubsI
21457448 GRCh37
21348715 NCBI36
753502
GTACGTCCTAGTAGGCAATATTGTA C → T GTGGAATGGGTGAAACTCCCATCCT
Reduced uptake of estrone sulfate and methotrexate in oocytes. PMID: 19940846.
-168
Arg → Cys
(D=180)
n=
C/C=
C/T=
T/T=
T=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 5: CodingPDE6 pubsI
21457434 GRCh37
21348701 NCBI36
767516
GCAATATTGTACGTGGAATGGGTGA A → C ACTCCCATCCTGCCTTTGGGTATTT
Reduced uptake of estrone sulfate and methotrexate in oocytes. PMID: 19940846.
-172
Glu → Asp
(D=45)
n=
A/A=
A/C=
C/C=
C=
160
79
1
0
0.006
160
77
3
0
0.019
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDEI
21457352 GRCh37
21348619 NCBI36
  
TTCTCCTTTATATATTGGTAAGTAT G → A GAAATCTACCTTAGCTTCTTTTCAG
- 
 
n=
G/G=
G/A=
A/A=
A=
160
56
23
1
0.156
160
80
0
0
0.000
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 7: CodingPDE1 pubI
21453466 GRCh37
21344733 NCBI36
977726
TAACTCCCACTGACACTCGTTGGGT C → T GGTGCATGGTGGTTTGGCTTTCTGA
-242
Val = Val
n=
C/C=
C/T=
T/T=
T=
158
72
7
0
0.044
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE1 pubI
21453424 GRCh37
21344691 NCBI36
1019768
GCTTTCTGATTTGTGCAGGAGTTAA C → T GTGCTCACTGCCATTCCTTTTTTCT
-256
Asn = Asn
n=
C/C=
C/T=
T/T=
T=
158
71
8
0
0.051
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE2 pubsI
21453362 GRCh37
21344629 NCBI36
1081830
ACACTTCCAAAGGAAGGACTAGAGA C → A TAATGCTGACATCATTAAAAATGAA
-277
Thr → Asn
(D=65)
n=
C/C=
C/A=
A/A=
A=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE2 pubs
21453359 GRCh37
21344626 NCBI36
1084833
CTTCCAAAGGAAGGACTAGAGACTA A → - TGCTGACATCATTAAAAATGAAAAT
Reduced uptake of estrone sulfate and methotrexate in oocytes. PMID: 19940846.
-278
Asn → DEL
n=
A/A=
A/-=
-/-=
-=
158
78
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE1 pub
21453355 GRCh37
21344622 NCBI36
1088837
CAAAGGAAGGACTAGAGACTAATGC T → G GACATCATTAAAAATGAAAATGAAG
-279
Ala = Ala
n=
T/T=
T/G=
G/G=
G=
158
79
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 7: CodingPDE2 pubsI
21453351 GRCh37
21344618 NCBI36
1092841
GGAAGGACTAGAGACTAATGCTGAC A → G TCATTAAAAATGAAAATGAAGACAA
-281
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
158
79
0
0
0.000
160
80
0
0
0.000
120
59
1
0
0.008
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
21450519 GRCh37
21341786 NCBI36
  
AAGCCAAGTTCGTTTGACACAGTTG T → A CATTCTTTCATTTCAGATTTTCTAC
- 
 
n=
T/T=
T/A=
A/A=
A=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDE2 pubsI
21450445 GRCh37
21341712 NCBI36
1219968
AATCCAATTTATATGCTTTTCATAC T → C TGTAAGTGTGATACAGTTCAATGCA
-323
Leu → Pro
(D=98)
n=
T/T=
T/C=
C/C=
C=
160
80
0
0
0.000
160
79
1
0
0.006
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 8: CodingPDE2 pubs
21450350 GRCh37
21341617 NCBI36
13141063
ATATGGAATATCATCTTCAGATGCA A → G TCTTTCTAATGGGTATGTTTGTTTT
-355
Ile → Val
(D=29)
n=
A/A=
A/G=
G/G=
G=
160
80
0
0
0.000
160
77
3
0
0.019
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDE
21450295 GRCh37
21341562 NCBI36
  

C → A, T
TGCCTTACTAGCACACTTTCCCCCC C → A ACGAACAGTGTGATGGCGGGTGTAG
TGCCTTACTAGCACACTTTCCCCCC C → T ACGAACAGTGTGATGGCGGGTGTAG
- 

 
 
 
n=
C/C=
C/A=
A/A=
C/T=
T/T=
A/T=
A=
T=
160
80
0
0
0
0
0
0.000
0.000
160
77
2
0
1
0
0
0.013
0.006
120
60
0
0
0
0
0
0.000
0.000
100
48
0
0
2
0
0
0.000
0.020
12
6
0
0
0
0
0
0.000
0.000
Set-II
 PDE
21448741 GRCh37
21340008 NCBI36
  
GTAAGTCATTTTGTAAATAATATTT T → C ATTTGCATTTATAGGTATTTATAAC
- 
 
n=
T/T=
T/C=
C/C=
C=
160
74
6
0
0.037
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
21447066 GRCh37
21338333 NCBI36
  
ATTGAATCCTCTTTTAATATCTATG G → A CATTATTTTAAATCACTTCAGAATT
- 
 
n=
G/G=
G/A=
A/A=
A=
160
75
5
0
0.031
160
60
18
2
0.138
120
60
0
0
0.000
100
41
9
0
0.090
12
4
2
0
0.167
Set-II
Exon 10: CodingPDE1 pubI
21446936 GRCh37
21338203 NCBI36
16311380
CTGTGTGTGGAAACAATGGCTTGTC A → G TATCTGTCAGCTTGTCTTGCTGGTT
-460
Ser = Ser
n=
A/A=
A/G=
G/G=
G=
160
78
2
0
0.013
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
21445286 GRCh37
21336553 NCBI36
  
AAGATTTTTACTTCTTAGTATAATA T → C GTTATTTTTTGGCAGGTGTTCCAAA
- 
 
n=
T/T=
T/C=
C/C=
C=
160
69
11
0
0.069
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
21428371 GRCh37
21319638 NCBI36
  
TTATTTTTCTTTTATTTACAAACTT A → G TTTACTTTTCAGGTGTATGAAATCT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
49
27
4
0.219
160
72
8
0
0.050
120
25
25
10
0.375
100
48
2
0
0.020
12
3
2
1
0.333
Set-II
Exon 12: CodingPDE1 pub
21428307 GRCh37
21319574 NCBI36
19131662
TTGGTGTGGGATTACATACATTTTG C → T ACAAGAGTATTTGGTAAAAATAGTT
-554
Cys = Cys
n=
C/C=
C/T=
T/T=
T=
160
71
9
0
0.056
160
73
7
0
0.044
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
 PDEI
21428247 GRCh37
21319514 NCBI36
  
CACATCCTATCAGAACAATATTATT A → C TTATTATTTTTTATTACACTTTAAG
- 
 
n=
A/A=
A/C=
C/C=
C=
160
47
28
5
0.237
160
80
0
0
0.000
120
60
0
0
0.000
100
48
2
0
0.020
12
6
0
0
0.000
Set-II
 PDE
21428246 GRCh37
21319513 NCBI36
  
ACATCCTATCAGAACAATATTATTA T → G TATTATTTTTTATTACACTTTAAGT
- 
 
n=
T/T=
T/G=
G/G=
G=
160
64
16
0
0.100
160
79
1
0
0.006
120
25
25
10
0.375
100
49
1
0
0.010
12
3
2
1
0.333
Set-II
 PDE
21427586 GRCh37
21318853 NCBI36
  
TGCCGTACAAATAAAGAAAATTGAA A → G TATTTCCAAATAAATCAAGTATCTT
- 
 
n=
A/A=
A/G=
G/G=
G=
160
70
10
0
0.063
160
79
1
0
0.006
120
50
0
10
0.167
100
50
0
0
0.000
12
4
1
1
0.250
Set-II
 
21427548 GRCh37
21318815 NCBI36
  
AATCAAGTATCTTAATTCTTGTTGA T → TTGAT AGATTTTTCTTTCCCTGTCAATTGT
- 
 
n=
T/T=
T/TTGAT=
TTGAT/TTGAT=
TTGAT=
160
79
1
0
0.006
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
 PDE
21422716 GRCh37
21313983 NCBI36
  
CTATGTAATATTTAATATGTTTTAA C → A TTTTAAAAAAATAGATACATCTACC
- 
 
n=
C/C=
C/A=
A/A=
A=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 14: CodingPDE3 pubsIA
21422492 GRCh37
21313759 NCBI36
22542003
GTTTTGAAAGATGATGAATTGAAAA C → G TAAATTGTAATTGTCCTATTATATT
-668
Thr → Ser
(D=58)
n=
C/C=
C/G=
G/G=
G=
160
73
7
0
0.044
160
80
0
0
0.000
120
60
0
0
0.000
100
49
1
0
0.010
12
6
0
0
0.000
Set-II
Exon 14: 3UTRPDE
21422479 GRCh37
21313746 NCBI36
2267 
ATGAATTGAAAACTAAATTGTAATT G → T TCCTATTATATTACTTTTTTCAGAA
- 
 
n=
G/G=
G/T=
T/T=
T=
160
72
8
0
0.050
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
6
0
0
0.000
Set-II
Exon 14: 3UTRPDE
21422432 GRCh37
21313699 NCBI36
2314 
AGAATTAGAGAACATGCTGTACAAC T → - TAATTGTTTTAAAAATCAGTAGAGA
- 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 14: 3UTRPDE
21422431 GRCh37
21313698 NCBI36
2315 
GAATTAGAGAACATGCTGTACAACT T → - AATTGTTTTAAAAATCAGTAGAGAT
- 
 
n=
T/T=
T/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 14: 3UTRPDE
21422430 GRCh37
21313697 NCBI36
2316 
AATTAGAGAACATGCTGTACAACTT A → - ATTGTTTTAAAAATCAGTAGAGATA
- 
 
n=
A/A=
A/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 14: 3UTRPDE
21422429 GRCh37
21313696 NCBI36
2317 
ATTAGAGAACATGCTGTACAACTTA A → - TTGTTTTAAAAATCAGTAGAGATAT
- 
 
n=
A/A=
A/-=
-/-=
-=
160
80
0
0
0.000
160
80
0
0
0.000
120
60
0
0
0.000
100
50
0
0
0.000
12
5
1
0
0.083
Set-II
Exon 14: 3UTRPDE
21422414 GRCh37
21313681 NCBI36
2332 
AAAAAGTTATCTATTATATCTCTAC T → C GATTTTTAAAACAATTAAGTTGTAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21422365 GRCh37
21313632 NCBI36
2381 
ACATTTTATTATTTTGAGTTAAGAG G → T TTTTTTAGGTTCTTAAAGACAAGAA
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
19
39
10
0.434
132
45
19
2
0.174
136
31
27
10
0.346
136
54
13
1
0.110
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422353 GRCh37
21313620 NCBI36
2393 
TATCATTAGTGAACATTTTATTATT T → C TGAGTTAAGAGGTTTTTTAGGTTCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
132
64
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422319 GRCh37
21313586 NCBI36
2427 
TAGGAAAACTCAAGTGTCACTGATA C → T CTTAGAAATATCATTAGTGAACATT
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
132
66
0
0
0.000
136
68
0
0
0.000
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21422253 GRCh37
21313520 NCBI36
2493 
GTTTCAACATAAAAATAAAGCTGGC T → G CTAAGAATCTTCTTTAGGGGGCTGT
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
27
34
7
0.353
132
50
14
2
0.136
136
68
0
0
0.000
136
54
13
1
0.110
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422169 GRCh37
21313436 NCBI36
2577 
TTCATAACAGAAAATTTTTAGAAGT A → G TTAGTAGAAGGAGATGTAGGAAGTA
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422140 GRCh37
21313407 NCBI36
2606 
AGAACAAATTTAGTGGAATTAAATA G → T GTTTTCATAACAGAAAATTTTTAGA
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
65
3
0
0.022
132
66
0
0
0.000
136
68
0
0
0.000
136
67
1
0
0.007
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422065 GRCh37
21313332 NCBI36
2681 
ATAAACTTGAATAAAATATTTAAAT C → T TTCACATAACAGAATGAGAATTTAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
66
2
0
0.015
132
61
5
0
0.038
136
68
0
0
0.000
136
66
2
0
0.015
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422016 GRCh37
21313283 NCBI36
2730 
CGATTCCTAAATAGAATAAGAAGAT G → A TAGGCTTCTCTCACATGGAAGCGAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
68
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21422002 GRCh37
21313269 NCBI36
2744 
GAAGAGTTAAAGAACGATTCCTAAA T → C AGAATAAGAAGATGTAGGCTTCTCT
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
66
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421780 GRCh37
21313047 NCBI36
2966 
TTCAGACACTTGTTTGTAAGAAAAA C → T TTTAGTCACTGGATTTGAATTACTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
60
8
0
0.059
132
66
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21421770 GRCh37
21313037 NCBI36
2976 
CATCCTTTGATTCAGACACTTGTTT G → T TAAGAAAAACTTTAGTCACTGGATT
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
42
24
2
0.206
132
45
19
2
0.174
136
31
27
10
0.346
136
57
11
0
0.081
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421764 GRCh37
21313031 NCBI36
2982 
TCCTTTCATCCTTTGATTCAGACAC T → C TGTTTGTAAGAAAAACTTTAGTCAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
68
0
0
0.000
132
66
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
n/a
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqPA FreqSample Set
Exon 14: 3UTRPDE
21421458 GRCh37
21312725 NCBI36
3288 
TATATTAATCAATAAGTCCTCTTCT A → G TGTCTAAAATCCTTCAATTTTTAAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
49
16
3
0.162
136
67
1
0
0.007
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421444 GRCh37
21312711 NCBI36
3302 
TTTACCAGAAGCCCTATATTAATCA A → G TAAGTCCTCTTCTATGTCTAAAATC
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421412 GRCh37
21312679 NCBI36
3334 
AAACAGGTATTTGTCTGTTCATTCT A → G TTCTCTTTTACCAGAAGCCCTATAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21421343 GRCh37
21312610 NCBI36
3403 
CCATTAGGGATTTATGTCATTCTTA T → C ATATTGACTGTCATTTCAACAGGAA
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
25
36
7
0.368
136
51
15
2
0.140
136
68
0
0
0.000
134
53
13
1
0.112
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421325 GRCh37
21312592 NCBI36
3421 
TTACTCCATTCTCTTCATCCATTAG G → T GATTTATGTCATTCTTATATATTGA
+ 
 
n=
G/G=
G/T=
T/T=
T=
136
68
0
0
0.000
136
67
1
0
0.007
136
68
0
0
0.000
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21421255 GRCh37
21312522 NCBI36
3491 
ACACTCTCACTCCATTTATAGTACA C → T ATAAATAACCATAGTGTATTGACAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
49
19
0
0.140
136
63
5
0
0.037
136
31
27
10
0.346
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21421039 GRCh37
21312306 NCBI36
3707 
CATTTGCTTTCTTTTTTCATATGAT G → A CATCTGATCATTTAGGAAATCATAT
+ 
 
n=
G/G=
G/A=
A/A=
A=
136
13
42
13
0.500
136
46
20
2
0.176
136
31
27
10
0.346
134
53
13
1
0.112
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21421016 GRCh37
21312283 NCBI36
3730 
GTTCTATACAGCCTTTCTCTTCTCA TTTGCTTTC → - TTTTTTCATATGATGCA
+ 
 
n=
TTTGCTTTC/TTTGCTTTC=
TTTGCTTTC/-=
-/-=
-=
136
49
19
0
0.140
136
63
5
0
0.037
136
31
27
10
0.346
134
67
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDEIA
21420712 GRCh37
21311979 NCBI36
4034 
TGCTGCTCTGTGAATATAGGTAAGT C → A TCTTCTCCTTGTTTTAGTTTCCAGG
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
62
6
0
0.044
136
49
17
2
0.154
136
68
0
0
0.000
136
58
10
0
0.074
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21420624 GRCh37
21311891 NCBI36
4122 
CAGAAATGAGCATTCTCTTCACCAT C → T GCACACTCAGCAAAATCTGATTCCC
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
64
4
0
0.029
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21420612 GRCh37
21311879 NCBI36
4134 
CAGATTCCAGTTCAGAAATGAGCAT T → G CTCTTCACCATCGCACACTCAGCAA
+ 
 
n=
T/T=
T/G=
G/G=
G=
136
63
5
0
0.037
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21420568 GRCh37
21311835 NCBI36
4178 
ATAAGTCTAACTTCCATATATATCC T → C ATTTGCTTCTTTTTAGCTCAGATTC
+ 
 
n=
T/T=
T/C=
C/C=
C=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDEI
21420471 GRCh37
21311738 NCBI36
4275 
GAACTAACCTCATTATGTCCTCTGC C → T CCCATTTATGTCAGTCACCTAAATA
+ 
 
n=
C/C=
C/T=
T/T=
T=
136
9
40
19
0.574
136
29
33
6
0.331
136
31
27
10
0.346
136
46
18
4
0.191
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21420447 GRCh37
21311714 NCBI36
4299 
ACACTATCTGCCTTGAATCCGTAAG AACT → - AACCTCATTATGTCCTCTGCCC
+ 
 
n=
AACT/AACT=
AACT/-=
-/-=
-=
136
66
2
0
0.015
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272
Exon 14: 3UTRPDE
21420380 GRCh37
21311647 NCBI36
4366 
CACGACAAGAGGTCATCAGGGAGCC C → A AGTCACCACCTCGCCTAATTTTGAC
+ 
 
n=
C/C=
C/A=
A/A=
A=
136
67
1
0
0.007
136
68
0
0
0.000
136
68
0
0
0.000
136
68
0
0
0.000
n/a
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.