UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATP1B1
HGNC Symbol:SLCO1B1
HGNC Description:solute carrier organic anion transporter family, member 1B1
HGNC ID:10959
Superfamily:SLC
Chromosome:Chr.12(+): 21284128-21392730 GRCh37
Location:12p
OMIM:604843
OMIM Phenotype:None
Accessions:NM_006446
Nucleotide RefSeq:NM_006446
Protein RefSeq:NP_006437
Entrez:10599
Ensembl:ENSG00000134538
Isoforms:1
Evidence:Substrate In Vitro Evidence: Substrate System Reference Bile salts: cholate NA [3] glycocholate NA [3] taurocholate X oocytes [1] Hormones and their conjugates: dehydroepiandrosterone-sulfate (DHEAS) X oocytes [1] estradiol-17?-glucuronide X oocytes [1] estrone-3-sulfate X oocytes [1] T3 X oocytes [1] T4 X oocytes [1] Eicosanoids: Leukotriene C4 X oocytes [1] Leukotriene E4 X oocytes [1] prostaglandine E2 X oocytes [1] thromboxane B2 X oocytes [1] Drugs: benzylpenicillin HEK-293 cells [6] pravastatin HEK-293 cells [4] rifampicin X oocytes [7] Other organic anions: bilirubin HEK-293 cells [2] monoglucuronosyl bilirubin HEK-293 cells [5] HEK-293 cells [2] bisglucuronosyl bilirubin HEK-293 cells [2] sulfobromophthalein (BSP) HEK-293 cells [2] Tissue Distribution Evidence: liver Northern [1] References: 1. Abe, T., et al., Identification of a novel gene family encoding human liver-specific organic anion transporter LST-1. J Biol Chem, 1999. 274(24): p. 17159-63. 2. Cui, Y., et al., Hepatic uptake of bilirubin and its conjugates by the human organic anion transporter SLC21A6. J Biol Chem, 2001. 276(13): p. 9626-30. 3. Hagenbuch, B. and P.J. Meier, The superfamily of organic anion transporting polypeptides. Biochim Biophys Acta, 2003. 1609(1): p. 1-18. 4. Hsiang, B., et al., A novel human hepatic organic anion transporting polypeptide (OATP2). Identification of a liver-specific human organic anion transporting polypeptide and identification of rat and human hydroxymethylglutaryl-CoA reductase inhibitor transporters. J Biol Chem, 1999. 274(52): p. 37161-8. 5. Konig, J., et al., A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol, 2000. 278(1): p. G156-64. 6. Tamai, I., et al., Molecular identification and characterization of novel members of the human organic anion transporter (OATP) family. Biochem Biophys Res Commun, 2000. 273(1): p. 251-60. 7. Vavricka, S.R., et al., Interactions of rifamycin SV and rifampicin with organic anion uptake systems of human liver. Hepatology, 2002. 36(1): p. 164-72.
Tissues:liver
Type:protein-coding
Sets:IV
PharmGKB ID:PA134865839
HPRD ID:09214
Substrates:Cholate, glycocholate, taurocholate, dehydroepiandrosterone-sulfate, estradiol-17b-glucuronide, estrone-3-sulfate, T3, T4, Leukotriene C4, Leukotriene E4, prostaglandine E2,thromboxane B2, benzylpenicillin, pravastatin, rifampicin, bilirubin, monoglucuronosyl bilirubin, bisglucuronosyl bilirubin, sulfobromophthalein
Trivial Names:LST1, HBLRR, LST-1, OATP2, OATPC, OATP-C, OATP1B1, SLC21A6
Transcripts:NM_006446.4 [Chr.12(+): 21284128-21392730 GRCh37]
ENST00000256958 [Chr.12(+): 21284136-21392180 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO1B1.

Variant Data

View all PMT variants for SLCO1B1 on UCSC Genome Browser
Showing SNP features for transcript: NM_006446  
SLCO1B1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO1B1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
21283520 GRCh37
21174787 NCBI36
-608-10989
TTAATTAAACTTCATCTCTACTCAA G → A AAAACTTTTAACTGAGTTAAGCTCT
+ 
 
A=
0.008
0.000
0.015
0.000
PMT-272
 PDE
21283631 GRCh37
21174898 NCBI36
-497-10878
TTTGATGTAAAGAATCTATCGCATA A → G AGCAGTCTTAATTTTCATCATTCAG
+ 
 
G=
0.008
0.000
0.000
0.000
PMT-272
 PDE
21283742 GRCh37
21175009 NCBI36
-386-10767
ACATACCACGTTAGAACCATACTTA T → C GTACCAAGCAAAGAGGGTATATTTT
+ 
 
C=
0.000
0.000
0.008
0.000
PMT-272
 PDEI
21283819 GRCh37
21175086 NCBI36
-309-10690
AGGCATATTTTTTATTTGTCTTAAA T → C TATTTCCTATTTGGAAGTTTTAAAT
+ 
 
C=
0.159
0.007
0.023
0.007
PMT-272
PromoterPDE
21283880 GRCh37
21175147 NCBI36
-248-10629
ATTTATTGTACTCATATTTTTAAAG A → - AAAAAATCTTATGCCACCAACTTAA
+ 
 
n=
A/A=
A/-=
-/-=
-=
134
67
0
0
0.000
128
64
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
PMT-272
PromoterPDE
21283981 GRCh37
21175248 NCBI36
-147-10528
ATTAACAAAAAATAATGTGAGAATT C → G TGAGAAATATAATCTTTAAATATTG
+ 
 
G=
0.008
0.000
0.000
0.000
PMT-272
PromoterPDE2 pubs
21284010 GRCh37
21175277 NCBI36
-118-10499
GAAATATAATCTTTAAATATTGGCA A → C CTGGAGTGAACTCTTAAAACTAACT
+ 
 
n=
A/A=
A/C=
C/C=
C=
134
66
1
0
0.007
128
57
7
0
0.055
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
PromoterPDE
21284126 GRCh37
21175393 NCBI36
-2-10383
CAAAAAGCCAACTACTTTAAGAGGA A → G TAAAGGGTGGACTTGTTGCAGTTGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
67
0
0
0.000
128
64
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
21284235 GRCh37
21175502 NCBI36
 -10274
TATGTAAGAAATTTTCACGGAAGAA G → C ATTTTGATGGTCTTGAAAAATATTA
+ 
 
C=
0.000
0.000
0.045
0.000
PMT-272
 PDE
21284261 GRCh37
21175528 NCBI36
 -10248
ATTTTGATGGTCTTGAAAAATATTA C → T GAATTTTATGCTCTGTGTCTTCCAC
+ 
 
T=
0.008
0.000
0.000
0.000
PMT-272
 PDE
21294674 GRCh37
21185941 NCBI36
  
TAGAAAAGCAAGTTGTTAAAAAGAA C → T ATTATGTTTCAAATTATAATTTTCA
+ 
 
T=
0.000
0.000
0.016
0.000
PMT-272
 PDE
21294702 GRCh37
21185969 NCBI36
  
TATGTTTCAAATTATAATTTTCAAT T → G GAAGCATATATTGAAATATTAACAT
+ 
 
G=
0.007
0.000
0.000
0.000
PMT-272
 PDE
21294710 GRCh37
21185977 NCBI36
  
AAATTATAATTTTCAATTGAAGCAT A → G TATTGAAATATTAACATAATGATTC
+ 
 
G=
0.051
0.008
0.000
0.000
PMT-272
 PDE
21294760 GRCh37
21186027 NCBI36
  
CATACCTTGATTTAAACCAGTCTTT T → C AATCTGATTAAGTATTTCTTTGGCG
+ 
 
C=
0.000
0.000
0.008
0.000
PMT-272
 PDEI
21294785 GRCh37
21186052 NCBI36
  
TAATCTGATTAAGTATTTCTTTGGC G → A AAATTTTTGATGCTTAATAGTTTAT
+ 
 
A=
0.022
0.000
0.109
0.000
PMT-272
 PDE
21294795 GRCh37
21186062 NCBI36
  
AAGTATTTCTTTGGCGAAATTTTTG A → T TGCTTAATAGTTTATCAATGTAGAA
+ 
 
T=
0.015
0.068
0.008
0.037
PMT-272
 PDE
21294799 GRCh37
21186066 NCBI36
  
ATTTCTTTGGCGAAATTTTTGATGC T → C TAATAGTTTATCAATGTAGAAAATT
+ 
 
C=
0.059
0.008
0.000
0.000
PMT-272
 PDE
21294800 GRCh37
21186067 NCBI36
  
TTTCTTTGGCGAAATTTTTGATGCT T → A AATAGTTTATCAATGTAGAAAATTT
+ 
 
A=
0.059
0.008
0.000
0.000
PMT-272
 PDE
21325808 GRCh37
21217075 NCBI36
  
TTTACACCACTGGTTATCAACTGGG G → A TAAATTTATCTCTCACAGGCAATTT
+ 
 
A=
0.051
0.000
0.000
0.000
PMT-272
 PDEI
21325814 GRCh37
21217081 NCBI36
  
CCACTGGTTATCAACTGGGGTAAAT T → G TATCTCTCACAGGCAATTTGGCAAT
+ 
 
G=
0.449
0.063
0.309
0.059
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 5: CodingPDE73 pubsI
21329738 GRCh37
21221005 NCBI36
492388
CAGGTATTCTAAAGAAACTAATATC A → G ATTCATCAGAAAATTCAACATCGAC
Approximately 50% of the variation in ANC nadir in cancer patients is explained by rs3765129, rs2306283 and UGT1A1*93; the AUC of irinotecan, SN-38, SN-38 glucuronide and APC are influenced by rs3740066, rs2306283, rs35605, rs10276036, and rs717620. PMID: 19940846.
+130
Asn → Asp
(D=23)
G=
0.728
0.441
0.801
0.478
PMT-272
Exon 5: CodingPDE5 pubsIA
21329761 GRCh37
21221028 NCBI36
515411
TCAATTCATCAGAAAATTCAACATC G → A ACCTTATCCACTTGTTTAATTAATC
+137
Ser = Ser
A=
0.088
0.250
0.000
0.074
PMT-272
Exon 5: CodingPDE15 pubsA
21329813 GRCh37
21221080 NCBI36
567463
AATTTTATCACTCAATAGAGCATCA C → A CTGAGATAGTGGGAAAAGGTAAGAA
+155
Pro → Thr
(D=38)
A=
0.066
0.162
0.000
0.059
PMT-272
 PDE
21329832 GRCh37
21221099 NCBI36
  
GCATCACCTGAGATAGTGGGAAAAG G → T TAAGAATTAATATTGACAGTAAAAA
+ 
 
T=
0.022
0.000
0.000
0.000
PMT-272
 PDEI
21329991 GRCh37
21221258 NCBI36
  
AATTATAGTGTTAATATACACAGTT C → T GCCCATTAACAACACAGGTTTAAAC
+ 
 
T=
0.051
0.176
0.000
0.059
PMT-272
 PDE
21329996 GRCh37
21221263 NCBI36
  
TAGTGTTAATATACACAGTTCGCCC A → T TTAACAACACAGGTTTAAACTACGC
+ 
 
T=
0.456
0.221
0.507
0.176
PMT-272
 PDE
21330020 GRCh37
21221287 NCBI36
  
CATTAACAACACAGGTTTAAACTAC G → A CGTTTTCACTTCTATGCAAATTTTG
+ 
 
A=
0.471
0.257
0.507
0.184
PMT-272
 PDEI
21330022 GRCh37
21221289 NCBI36
  
TTAACAACACAGGTTTAAACTACGC G → A TTTTCACTTCTATGCAAATTTTGTC
+ 
 
A=
0.140
0.463
0.250
0.456
PMT-272
 PDE
21331396 GRCh37
21222663 NCBI36
  
TTGCAAAGTGAATATAAATTACTTG TACTTG → - TAAATTAAAAAAAAATAAGT
+ 
 
-=
0.568
0.477
0.448
0.345
PMT-272
 PDE
21331499 GRCh37
21222766 NCBI36
  
TAATGTTTAAAATGAAACACTCTCT T → C ATCTACATAGGTTGTTTAAAGGAAT
+ 
 
C=
0.015
0.000
0.000
0.000
PMT-272
Exon 6: CodingPDE149 pubsIA
21331549 GRCh37
21222816 NCBI36
625521
TCTGGGTCATACATGTGGATATATG T → C GTTCATGGGTAATATGCTTCGTGGA
+174
Val → Ala
(D=64)
C=
0.061
0.172
0.112
0.155
PMT-272
Exon 6: CodingPDE6 pubsIA
21331599 GRCh37
21222866 NCBI36
675571
AATAGGGGAGACTCCCATAGTACCA T → C TGGGGCTTTCTTACATTGATGATTT
+191
Leu = Leu
C=
0.318
0.578
0.302
0.422
PMT-272
Exon 6: CodingPDE7 pubsIA
21331625 GRCh37
21222892 NCBI36
701597
TGGGGCTTTCTTACATTGATGATTT C → T GCTAAAGAAGGACATTCTTCTTTGT
+199
Phe = Phe
T=
0.545
0.453
0.422
0.310
PMT-272
Exon 7: CodingPDE
21331891 GRCh37
21223158 NCBI36
768664
TGCAATAGCAATGATTGGTCCAATC A → G TTGGCTTTACCCTGGGATCTCTGTT
+222
Ile → Val
(D=29)
G=
0.012
0.000
0.000
0.000
PMT-272
 PDEIA
21331987 GRCh37
21223254 NCBI36
  
CAACCAGAACAAGGTACCATGATAA C → T GTCTTTCTAAGCACACATGCGAAAA
+ 
 
T=
0.155
0.402
0.243
0.406
PMT-272
 PDE
21332044 GRCh37
21223311 NCBI36
  
TTTCAAATAACTGAATTCACTCTTT CAATAGTCCTTT → - GCTTAATATAATTA
+ 
 
-=
0.024
0.000
0.000
0.000
PMT-272
Exon 9: CodingPDE
21353505 GRCh37
21244772 NCBI36
11381034
CTGTATGTTATGTTTGTGCTTTTGA C → T GTTGTTACAAGTAAGCAGCTATATT
+345
Thr → Met
(D=81)
T=
0.000
0.007
0.000
0.000
PMT-272
Exon 9: CodingPDE1 pub
21353557 GRCh37
21244824 NCBI36
11901086
GTGCTTTTACTTATGTCTTCAAATA C → T GTAGAGCAACAGTATGGTCAGCCTT
+362
Tyr = Tyr
T=
0.030
0.000
0.000
0.007
PMT-272
 PDE
21353629 GRCh37
21244896 NCBI36
  
TGGGTAAGACATATTTTTTACTTGT G → A TGCTTAATAAGTGAAATAATACTAA
+ 
 
A=
0.000
0.000
0.000
0.015
PMT-272
 PDEI
21353648 GRCh37
21244915 NCBI36
  
ACTTGTGTGCTTAATAAGTGAAATA A → C TACTAAATACTGTATTCCAAGTGGT
+ 
 
C=
0.053
0.000
0.000
0.007
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDEI
21353672 GRCh37
21244939 NCBI36
  
AATACTAAATACTGTATTCCAAGTG G → A TATTTTATTGTGAAAGTGATTTTGT
+ 
 
A=
0.061
0.000
0.000
0.007
PMT-272
 PDE
21355290 GRCh37
21246557 NCBI36
  
CAAACATGCACATTCTGCACATGTA T → C CCCAGAACTTAAAGTAAAATTTTAA
+ 
 
C=
0.023
0.000
0.000
0.000
PMT-272
 PDE
21355407 GRCh37
21246674 NCBI36
  
GAAAACTCATATATGATTACAACTT T → G TTTTCTTTTTTTTCTAGGAGTCATA
+ 
 
G=
0.000
0.000
0.000
0.008
PMT-272
Exon 10: CodingPDE
21355489 GRCh37
21246756 NCBI36
13041200
TAGGAGGATATATCATTAAAAAATT C → G AAACTGAACACCGTTGGAATTGCCA
+400
Phe → Leu
(D=22)
G=
0.023
0.000
0.000
0.008
PMT-272
Exon 10: CodingPDEIA
21355537 GRCh37
21246804 NCBI36
13521248
CCAAATTCTCATGTTTTACTGCTGT G → A ATGTCATTGTCCTTTTACCTATTAT
+416
Val = Val
A=
0.068
0.000
0.000
0.008
PMT-272
 PDE
21355629 GRCh37
21246896 NCBI36
  
ACCATGACCTATGATGGGTTTGTAT A → G TATCACTATATCAATTGCATAATAT
+ 
 
G=
0.008
0.000
0.000
0.000
PMT-272
 PDE
21355729 GRCh37
21246996 NCBI36
  
CAATTTTAACTAAACTTTCTTTAAG TTAAG → - AGAAATTTCAATTTTAAAATT
+ 
 
-=
0.008
0.000
0.000
0.000
PMT-272
 PDE
21358695 GRCh37
21249962 NCBI36
  
ATAAAGAAAAATTCTTTATCTACTT T → TTTC TTTTCCCTCTTTCTCTGCTTTCACT
+ 
 
TTTC=
0.588
0.485
0.632
0.382
PMT-272
 PDE
21358783 GRCh37
21250050 NCBI36
  
TTCTCTCTCTCTCTTTTTGATATAT G → C TCTATCATATATTTCCAGAAATAAT
+ 
 
C=
0.015
0.000
0.000
0.007
PMT-272
Exon 11: CodingPDE3 pubs
21358933 GRCh37
21250200 NCBI36
15671463
ACTTACATCTCACCCTGTCTAGCAG G → C TTGCAAATCTTCAAGTGGCAATAAA
+488
Gly → Ala
(D=60)
C=
0.029
0.000
0.000
0.000
PMT-272
 PDEA
21369883 GRCh37
21261150 NCBI36
  
ATTGTCTTATATAGAAAGAAATCCA C → G AAAACTATTTTACCTTTTATCTCTT
+ 
 
G=
0.324
0.110
0.243
0.136
PMT-272
 PDEI
21369964 GRCh37
21261231 NCBI36
  
CTGTAAATATATTAGTTTGAACAAG T → C GAGACTTCACTAAATATAATGCAAT
+ 
 
C=
0.294
0.103
0.243
0.129
PMT-272
 PDE
21369978 GRCh37
21261245 NCBI36
  
GTTTGAACAAGTGAGACTTCACTAA A → - TATAATGCAATGTATTTGCAGCACT
+ 
 
-=
0.169
0.206
0.441
0.176
PMT-272
 PDEI
21369985 GRCh37
21261252 NCBI36
  
CAAGTGAGACTTCACTAAATATAAT G → A CAATGTATTTGCAGCACTGTTAGGT
+ 
 
A=
0.110
0.070
0.295
0.121
PMT-272
 PDE
21370041 GRCh37
21261308 NCBI36
  
AAATTTCTTATGTCATATTTTATAC A → G CAACGCTTAAGGTGTTTTACAACTG
+ 
 
G=
0.000
0.000
0.023
0.000
PMT-272
 PDE
21370045 GRCh37
21261312 NCBI36
  
TTCTTATGTCATATTTTATACACAA C → T GCTTAAGGTGTTTTACAACTGCAGT
+ 
 
T=
0.000
0.000
0.008
0.000
PMT-272
 PDE
21370275 GRCh37
21261542 NCBI36
  
TTTAAAAACATTTTCATATGCATGA G → C ACTATAAACACACCTAATGATATGC
+ 
 
C=
0.007
0.000
0.000
0.000
PMT-272
 PDE
21375103 GRCh37
21266370 NCBI36
  
TTTTAAAACAATTAAAATATAATTT T → G ATATAATGGGGCCATTCAACTGTGA
+ 
 
G=
0.007
0.015
0.007
0.000
PMT-272
 PDE
21375122 GRCh37
21266389 NCBI36
  
TAATTTTATATAATGGGGCCATTCA A → T CTGTGAGCTTAATTCTATCATGGAG
+ 
 
T=
0.000
0.007
0.000
0.007
PMT-272
 PDE
21375159 GRCh37
21266426 NCBI36
  
ATTCTATCATGGAGAAAAACAACAC A → G GGAGAAGGTTTAATGTTGTTTCGTT
+ 
 
G=
0.066
0.000
0.000
0.007
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
Exon 13: CodingPDE
21375275 GRCh37
21266542 NCBI36
18281724
TTGAAATCACTTGCACTGGGTTTCC A → T CTCAATGGTTATACGAGCACTAGGT
+575
His → Leu
(D=99)
T=
0.000
0.007
0.000
0.000
PMT-272
 PDE
21375307 GRCh37
21266574 NCBI36
  
GGTTATACGAGCACTAGGTATGATG A → G AAAAAAAAAAAAAAAAAAAAAAAAA
+ 
 
G=
0.007
0.051
0.000
0.037
PMT-272
 PDE
21377832 GRCh37
21269099 NCBI36
  
CTTTGACTATATTAATTCCTAAAAA A → - TATCATTTTCATTATATAATAATAT
+ 
 
-=
0.000
0.000
0.000
0.015
PMT-272
Exon 15: CodingPDE5 pubs
21391976 GRCh37
21283243 NCBI36
20331929
CATCACTTGTTTTATATATTATATT A → C ATTTATGCCATGAAGAAAAAATATC
+643
Leu → Phe
(D=22)
C=
0.074
0.047
0.007
0.037
PMT-272
Exon 15: 3UTRPDE
21392163 GRCh37
21283430 NCBI36
2220 
CCACTTCTGCTTCTGTGTTTCCAAA C → G AGCATTGCATTGATTCAGTAAGATG
+ 
 
G=
0.000
0.000
0.007
0.000
PMT-272
Exon 15: 3UTRPDE
21392244 GRCh37
21283511 NCBI36
2301 
TAAGAATTTCCACATCTTTTATGGT G → C GAAGTATAAATAAGCCTATGAACTT
+ 
 
C=
0.015
0.000
0.000
0.000
PMT-272
Exon 15: 3UTRPDEI
21392290 GRCh37
21283557 NCBI36
2347 
AACTTATAATAAAACAAACTGTAGG T → C AGAAAAAATGAGAGTACTCATTGTT
+ 
 
C=
0.000
0.000
0.279
0.000
PMT-272
Exon 15: 3UTRPDEI
21392451 GRCh37
21283718 NCBI36
2508 
CTAATTCTTAATAAAACAAATGAGT A → G TCATACAGGTAGAGGTTAAAAAGGA
+ 
 
G=
0.000
0.000
0.015
0.000
PMT-272
Exon 15: 3UTRPDE1 pubI
21392562 GRCh37
21283829 NCBI36
2619 
AAACACAGAGTTTGAACTATAATAC T → G AAGGCCTGAAGTCTAGCTTGGATAT
+ 
 
G=
0.265
0.368
0.713
0.353
PMT-272
Exon 15: 3UTRPDEI
21392572 GRCh37
21283839 NCBI36
2629 
TTTGAACTATAATACTAAGGCCTGA A → C GTCTAGCTTGGATATATGCTACAAT
+ 
 
C=
0.074
0.265
0.000
0.125
PMT-272
Exon 15: 3UTRPDEI
21392586 GRCh37
21283853 NCBI36
2643 
CTAAGGCCTGAAGTCTAGCTTGGAT A → G TATGCTACAATAATATCTGTTACTC
+ 
 
G=
0.331
0.471
0.713
0.412
PMT-272
 PDEI
21392794 GRCh37
21284061 NCBI36
  
GTTTCCAGTGGGCCCACGGTAATGT A → G TTAGGAAAAATTGACTTTGACTAAT
+ 
 
G=
0.103
0.235
0.000
0.103
PMT-272
 PDEI
21392819 GRCh37
21284086 NCBI36
  
ATTAGGAAAAATTGACTTTGACTAA T → C GTAGCCACTCTCATACTTATCTTAG
+ 
 
C=
0.103
0.235
0.000
0.103
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.