UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPF
HGNC Symbol:SLCO1C1
HGNC Description:solute carrier organic anion transporter family, member 1C1
HGNC ID:13819
Superfamily:SLC
Chromosome:Chr.12(+): 20848289-20906320 GRCh37
Location:12p12.2
OMIM:613389
OMIM Phenotype:None
Accessions:NM_017435
Nucleotide RefSeq:NM_017435
Protein RefSeq:NP_059131
Entrez:53919
Ensembl:ENSG00000139155
Isoforms:8
Evidence:None
Tissues:brain&testis (high), heart (low)
Type:protein-coding
Sets:V
PharmGKB ID:PA37815
HPRD ID:08342
Substrates:Thyroid hormones T4 and rT3, BSP, estrone-3-sulfate, estradiol-17B-glucuronide
Trivial Names:OATP1, OATPF, OATP-F, OATP14, OATP1C1, OATPRP5, SLC21A14
Transcripts:NM_017435.4 [Chr.12(+): 20848399-20906320 GRCh37]
NM_001145946.1 [Chr.12(+): 20848289-20906320 GRCh37]
NM_001145945.1 [Chr.12(+): 20848289-20906320 GRCh37]
NM_001145944.1 [Chr.12(+): 20848399-20906320 GRCh37]
XM_005253394.1 [Chr.12(+): 20848289-20906320 GRCh37]
XM_005253395.1 [Chr.12(+): 20848289-20906320 GRCh37]
XM_005253396.1 [Chr.12(+): 20848289-20906320 GRCh37]
XM_005253397.1 [Chr.12(+): 20848289-20903720 GRCh37]
ENST00000266509 [Chr.12(+): 20848399-20906320 GRCh37]
ENST00000381552 [Chr.12(+): 20848399-20906318 GRCh37]
ENST00000497911 [Chr.12(+): 20848495-20853173 GRCh37]
ENST00000534996 [Chr.12(+): 20848289-20849909 GRCh37]
ENST00000535609 [Chr.12(+): 20848505-20850430 GRCh37]
ENST00000539415 [Chr.12(+): 20848365-20905630 GRCh37]
ENST00000539443 [Chr.12(+): 20848684-20849877 GRCh37]
ENST00000540354 [Chr.12(+): 20848396-20905751 GRCh37]
ENST00000545102 [Chr.12(+): 20848531-20906148 GRCh37]
ENST00000545604 [Chr.12(+): 20848289-20906318 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO1C1.

Variant Data

View all PMT variants for SLCO1C1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO1C1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO1C1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
20847981 GRCh37
20739248 NCBI36
-418-4530
AGAAATTGTAAATATGAGCAACTGA T → C CATGTCTCTGAGAATTAACTCTTTT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
65
0
0
0.000
126
63
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDEI
20847996 GRCh37
20739263 NCBI36
-403-4515
GAGCAACTGATCATGTCTCTGAGAA T → C TAACTCTTTTTGTACAGAGCGCTGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
40
23
2
0.208
126
62
1
0
0.008
134
57
9
1
0.082
134
64
3
0
0.022
PMT-272
 
20848096 GRCh37
20739363 NCBI36
-303-4415
CAATGGAAAAGAAAACCATGTAGCA A → G ATTAGCCCAAGAACCGTTAAAGACA
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
64
1
0
0.008
130
65
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
20848131 GRCh37
20739398 NCBI36
-268-4380
AGAACCGTTAAAGACAAAACAAAAC A → C AACCAAAACCAAAACACACAAACAA
+ 
 
n=
A/A=
A/C=
C/C=
C=
130
65
0
0
0.000
130
59
6
0
0.046
134
67
0
0
0.000
134
64
3
0
0.022
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.