UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPB
HGNC Symbol:SLCO2B1
HGNC Description:solute carrier organic anion transporter family, member 2B1
HGNC ID:10962
Superfamily:SLC
Chromosome:Chr.11(+): 74862032-74917445 GRCh37
Location:11q13
OMIM:604988
OMIM Phenotype:None
Accessions:NM_007256
Nucleotide RefSeq:NM_007256
Protein RefSeq:NP_009187
Entrez:11309
Ensembl:ENSG00000137491
Isoforms:4
Evidence:None
Tissues:None
Type:protein-coding
Sets:IV
PharmGKB ID:PA35845
HPRD ID:07061
Substrates:None
Trivial Names:OATPB, OATP-B, OATP2B1, SLC21A9
Transcripts:NM_007256.4 [Chr.11(+): 74862032-74917445 GRCh37]
NM_001145212.2 [Chr.11(+): 74862032-74917445 GRCh37]
NM_001145211.2 [Chr.11(+): 74870844-74917445 GRCh37]
XM_005273732.1 [Chr.11(+): 74862106-74917445 GRCh37]
ENST00000289575 [Chr.11(+): 74862032-74917594 GRCh37]
ENST00000341411 [Chr.11(+): 74862040-74917444 GRCh37]
ENST00000428359 [Chr.11(+): 74870833-74915762 GRCh37]
ENST00000454962 [Chr.11(+): 74862258-74917147 GRCh37]
ENST00000525650 [Chr.11(+): 74862160-74915781 GRCh37]
ENST00000525845 [Chr.11(+): 74870825-74875057 GRCh37]
ENST00000526660 [Chr.11(+): 74811608-74899278 GRCh37]
ENST00000526839 [Chr.11(+): 74876919-74881049 GRCh37]
ENST00000527180 [Chr.11(+): 74868116-74880286 GRCh37]
ENST00000528108 [Chr.11(+): 74907320-74911445 GRCh37]
ENST00000530012 [Chr.11(+): 74907299-74914453 GRCh37]
ENST00000530015 [Chr.11(+): 74910599-74917445 GRCh37]
ENST00000530556 [Chr.11(+): 74862833-74875057 GRCh37]
ENST00000531457 [Chr.11(+): 74862124-74873968 GRCh37]
ENST00000531713 [Chr.11(+): 74811636-74876875 GRCh37]
ENST00000531756 [Chr.11(+): 74862115-74914355 GRCh37]
ENST00000532236 [Chr.11(+): 74862106-74916036 GRCh37]
ENST00000534004 [Chr.11(+): 74863370-74875057 GRCh37]
ENST00000534186 [Chr.11(+): 74870829-74876993 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO2B1.

Variant Data

View all PMT variants for SLCO2B1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO2B1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO2B1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
74861950 GRCh37
74539598 NCBI36
-82-477
TTGGGGAGCTTGGGGAGACCCATCA G → A CATCCCCCCTGTGCCCCCACCTCTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
132
66
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
PromoterPDE
74861983 GRCh37
74539631 NCBI36
-49-444
CCTGTGCCCCCACCTCTCTGCTGCT A → C ACAGAGCAGGGGAAAATACCTAAGG
+ 
 
n=
A/A=
A/C=
C/C=
C=
132
61
5
0
0.038
132
66
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 1: 5UTRPDE
74862191 GRCh37
74539839 NCBI36
160-236
ACCCAGGGAGACAAACACTTGGAGA T → C ACTTGGGGCTGAGTTTGAGCAAGAC
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
66
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
130
65
0
0
0.000
PMT-272
Exon 1: 5UTRPDE1 pubI
74862356 GRCh37
74540004 NCBI36
325-71
TCCAGGAGCCCCTGAGAAGATTTGC T → C TCCTCTCCCCTGCTAAGCTCCAGGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
132
44
19
3
0.189
128
6
34
24
0.641
130
38
26
1
0.215
136
18
38
12
0.456
PMT-272
Exon 1: 5UTRPDEI
74862391 GRCh37
74540039 NCBI36
360-36
CTGCTAAGCTCCAGGTCCTGAGATT A → G AATTAGGGGCTGGAGCTCACTGCAC
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
0
0
66
1.000
128
0
0
64
1.000
130
0
11
54
0.915
136
0
0
68
1.000
PMT-272
 PDE
74862575 GRCh37
74540223 NCBI36
  
CAGCTGTTGGCACAGAGCCAGGCAC A → G TGGCCGGAGTTCAGTGAAGGTGTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
136
67
1
0
0.007
PMT-272
 PDE
74873659 GRCh37
74551307 NCBI36
  
CTAATCAGGTCAGGGCCATTCTCGG G → A GATTCTATCTATTCTCTTTCCCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
52
11
1
0.102
132
66
0
0
0.000
132
66
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 2: CodingPDE2 pubs
74873726 GRCh37
74551374 NCBI36
43843
GCCAGCGGGTGAGGTACCCCAGGTA C → T CAGACAAGGAAACCAAAGCCACAAT
+15
Pro → Ser
(D=74)
n=
C/C=
C/T=
T/T=
T=
128
62
2
0
0.016
132
66
0
0
0.000
132
66
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 2: CodingPDE
74873759 GRCh37
74551407 NCBI36
47176
GGAAACCAAAGCCACAATGGGCACA GAAAACACA → - CCTGGAGGCAAAGCCAG
+26
Glu → DEL
n=
GAAAACACA/GAAAACACA=
GAAAACACA/-=
-/-=
-=
128
63
1
0
0.008
132
62
4
0
0.030
132
52
14
0
0.106
132
64
2
0
0.015
PMT-272
 PDE
74873927 GRCh37
74551575 NCBI36
  
GCCAAGGAAGACTTTCTCTGAGCCT C → T GGTTTCCTCATCTATAGAATGTGTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
62
1
0
0.008
124
62
0
0
0.000
104
52
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
74873947 GRCh37
74551595 NCBI36
  
AGCCTCGGTTTCCTCATCTATAGAA T → A GTGTGGCTGTGAGGATCAAAGGGAT
+ 
 
n=
T/T=
T/A=
A/A=
A=
126
63
0
0
0.000
124
62
0
0
0.000
104
52
0
0
0.000
128
62
2
0
0.016
PMT-272
 PDE
74874030 GRCh37
74551678 NCBI36
  
ACATGGAAGGTGGCCAGTACATGTT C → T GCTCCTCCCAGAGAGGAAAGGGGTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
63
0
0
0.000
124
62
0
0
0.000
104
51
1
0
0.010
128
64
0
0
0.000
PMT-272
 PDE
74874064 GRCh37
74551712 NCBI36
  
CAGAGAGGAAAGGGGTGTTCTTGGA G → C TAGTACAGGATGAGGCACCCCTTGT
+ 
 
n=
G/G=
G/C=
C/C=
C=
126
63
0
0
0.000
124
61
1
0
0.008
104
52
0
0
0.000
128
64
0
0
0.000
PMT-272
 PDE
74874979 GRCh37
74552627 NCBI36
  
TCTTTGTCTCCCCCTGCACCGCCCA C → T CTCTGCCTGCCTCCGGGTCCCCCCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
52
11
1
0.102
134
66
1
0
0.007
136
62
6
0
0.044
134
63
4
0
0.030
PMT-272
 PDE
74876665 GRCh37
74554313 NCBI36
  
CTGCCCTCATTTCTCTCCCCTAAGG G → C GGCCGTGCGGCCCTTCCGAGGGGGA
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
60
6
0
0.045
134
67
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
74876740 GRCh37
74554388 NCBI36
  
TTTATTCAGTCCATTATTCAGATGG G → A CATACGGAAGTTAGACATAGAGACA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
74876745 GRCh37
74554393 NCBI36
  
TCAGTCCATTATTCAGATGGGCATA C → T GGAAGTTAGACATAGAGACAAGGAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
134
63
4
0
0.030
134
67
0
0
0.000
PMT-272
Exon 4: CodingPDE
74876885 GRCh37
74554533 NCBI36
734339
TGAGCTATTTTGGCAGCCGGGTGCA C → T CGACCCCGAATGATTGGCTATGGGG
+113
His = His
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
PMT-272
Exon 4: CodingPDEI
74876951 GRCh37
74554599 NCBI36
800405
TGGCGGGCCTGCTCATGACTCTCCC G → A CACTTCATCTCGGAGCCATACCGCT
+135
Pro = Pro
n=
G/G=
G/A=
A/A=
A=
132
58
7
1
0.068
134
67
0
0
0.000
134
67
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDEI
74877004 GRCh37
74554652 NCBI36
  
GACAACACCAGCCCTGGTAAGAGCA G → A CAGGGGCTGGGCAGGAGTGGGACGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
32
31
3
0.280
134
46
18
3
0.179
134
26
32
9
0.373
134
28
31
8
0.351
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
74877009 GRCh37
74554657 NCBI36
  
CACCAGCCCTGGTAAGAGCAGCAGG G → A GCTGGGCAGGAGTGGGACGTTAGCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
134
66
1
0
0.007
134
67
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
74877153 GRCh37
74554801 NCBI36
  

A → C, T
CCCCCAACCTGGCTCCCCAGGCCCC A → C GCCCAGGTGGGTCTCTGGCAGACCT
CCCCCAACCTGGCTCCCCAGGCCCC A → T GCCCAGGTGGGTCTCTGGCAGACCT
+ 

 
 
 
n=
A/A=
A/C=
C/C=
A/T=
T/T=
C/T=
C=
T=
132
22
15
1
21
3
4
0.159
0.235
134
46
0
0
18
3
0
0.000
0.179
134
26
0
0
32
9
0
0.000
0.373
134
27
1
0
31
8
0
0.007
0.351
PMT-272
 
74880156 GRCh37
74557804 NCBI36
  
CAGCACTTAGAACAGTACCTTCCCC C → CC GGGGTAAGCGCTATTTAAGTCTTAG
+ 
 
n=
C/C=
C/CC=
CC/CC=
CC=
130
54
9
2
0.100
122
51
10
0
0.082
134
28
31
8
0.351
134
33
26
8
0.313
PMT-272
Exon 5: CodingPDE
74880321 GRCh37
74557969 NCBI36
947552
ACTGCTCAAGCTACACAGAAACCCA G → A CATCTGAGTGTGGTGGGGATCATGT
+184
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
114
56
1
0
0.009
102
51
0
0
0.000
72
36
0
0
0.000
82
41
0
0
0.000
PMT-272
Exon 5: CodingPDE
74880357 GRCh37
74558005 NCBI36
983588
TGGTGGGGATCATGTTCGTGGCACA G → A ACCCTGCTGGGCGTGGGCGGGGTGC
+196
Gln = Gln
n=
G/G=
G/A=
A/A=
A=
114
56
1
0
0.009
102
49
2
0
0.020
72
36
0
0
0.000
82
39
2
0
0.024
PMT-272
Exon 5: CodingPDE3 pubs
74880370 GRCh37
74558018 NCBI36
996601
GTTCGTGGCACAGACCCTGCTGGGC G → A TGGGCGGGGTGCCCATTCAGCCCTT
+201
Val → Met
(D=21)
n=
G/G=
G/A=
A/A=
A=
114
56
1
0
0.009
102
51
0
0
0.000
72
33
3
0
0.042
82
40
1
0
0.012
PMT-272
 PDE
74880555 GRCh37
74558203 NCBI36
  
CTGGAGATGGAATCCCTGCCCCCTG C → T CCCATCTGGCCAGTAAAGGTCCAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
114
55
2
0
0.018
102
51
0
0
0.000
72
36
0
0
0.000
82
41
0
0
0.000
PMT-272
 PDE
74880588 GRCh37
74558236 NCBI36
  
GGCCAGTAAAGGTCCAGGGAAGCCC T → C GGAGAGTTCCCCATCCCTGACCAGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
114
54
3
0
0.026
102
51
0
0
0.000
72
36
0
0
0.000
82
41
0
0
0.000
PMT-272
 PDEA
74880856 GRCh37
74558504 NCBI36
  
TTGCTAGACCCTAGCTAACTGACTG C → A CACTCTCATAGGAGACATTGAGCCA
+ 
 
n=
C/C=
C/A=
A/A=
A=
114
20
27
10
0.412
102
41
8
2
0.118
72
27
2
7
0.222
82
25
8
8
0.293
PMT-272
 PDE
74883287 GRCh37
74560935 NCBI36
  
CCCAGGGTCACACAGGACACACCTG G → T CAGAGCAGACTGGAACTCAGGTCTC
+ 
 
n=
G/G=
G/T=
T/T=
T=
124
62
0
0
0.000
130
65
0
0
0.000
128
64
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 7: CodingPDE
74883453 GRCh37
74561101 NCBI36
1206811
TATCAGCCTGACCATAAAGGACCCC C → A GATGGGTGGGTGCCTGGTGGCTGGG
+271
Arg = Arg
n=
C/C=
C/A=
A/A=
A=
124
62
0
0
0.000
130
64
1
0
0.008
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 7: CodingPDE
74883559 GRCh37
74561207 NCBI36
1312917
CCCAAGGAAATGCCCAAGGAAAAAC G → A TGAGCTTCAGTTTCGGCGAAAGGTC
+306
Arg → His
(D=29)
n=
G/G=
G/A=
A/A=
A=
124
62
0
0
0.000
130
64
1
0
0.008
128
64
0
0
0.000
132
64
2
0
0.015
PMT-272
Exon 7: CodingPDE9 pubsIA
74883577 GRCh37
74561225 NCBI36
1330935
GAAAAACGTGAGCTTCAGTTTCGGC G → A AAAGGTCTTAGCAGTCACAGACTCA
+312
Arg → Gln
(D=43)
n=
G/G=
G/A=
A/A=
A=
124
50
11
1
0.105
130
54
11
0
0.085
128
25
30
9
0.375
132
34
25
7
0.295
PMT-272
Exon 7: CodingPDE
74883599 GRCh37
74561247 NCBI36
1352957
GGCGAAAGGTCTTAGCAGTCACAGA C → T TCACCTGCCAGGAAGGTAAGCTCCC
+319
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
124
61
1
0
0.008
130
65
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74883741 GRCh37
74561389 NCBI36
  
TGTAGTTCCAGCACTTTGGGAGGCC A → G AGGCGGTTGGATCACGAGGTCAGGA
+ 
 
n=
A/A=
A/G=
G/G=
G=
124
61
1
0
0.008
130
65
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74883749 GRCh37
74561397 NCBI36
  
CAGCACTTTGGGAGGCCAAGGCGGT T → C GGATCACGAGGTCAGGAGATCGAGA
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
61
1
0
0.008
130
65
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74883818 GRCh37
74561466 NCBI36
  
TGAAACCCCGTCTCTACTAAAAATA G → C AAAAAATTAGCCGGGCATGGTGGTG
+ 
 
n=
G/G=
G/C=
C/C=
C=
124
61
1
0
0.008
130
65
0
0
0.000
128
64
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74899151 GRCh37
74576799 NCBI36
  
CTGAGTGGGGTTGCTGGCATCCAGC G → A GACTGTCCTTGGTTTTGTGTCTCCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74899329 GRCh37
74576977 NCBI36
  
TTATGGGGAGCCAGGGCCAGAGGGG T → C CTTCGAGATTGTCAGGATCCAGTCC
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
74899523 GRCh37
74577171 NCBI36
  
TTGCGGCTCATGCCTGTAATCCCAG C → T ACTTTGGGAGGCCGAGGTGGACGGA
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
67
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
74899524 GRCh37
74577172 NCBI36
  
TGCGGCTCATGCCTGTAATCCCAGC A → G CTTTGGGAGGCCGAGGTGGACGGAT
+ 
 
n=
A/A=
A/G=
G/G=
G=
134
67
0
0
0.000
134
65
2
0
0.015
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74899537 GRCh37
74577185 NCBI36
  
TGTAATCCCAGCACTTTGGGAGGCC G → T AGGTGGACGGATCACTTGAGGTCAG
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
65
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 9: CodingPDE
74904474 GRCh37
74582122 NCBI36
16821287
TCATCGTGGGCATCGTGGTGGGTGG C → T GTCCTGGTCAAGCGGCTCCACCTGG
+429
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
116
58
0
0
0.000
114
57
0
0
0.000
130
65
0
0
0.000
120
59
1
0
0.008
PMT-272
 PDE
74907409 GRCh37
74585057 NCBI36
  
CTTCATTGCAAGGAGCTCACTATCA C → T GCCATCATCGGGCAGCCCTGATGAT
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
63
0
0
0.000
128
64
0
0
0.000
130
65
0
0
0.000
132
65
1
0
0.008
PMT-272
 PDE
74907418 GRCh37
74585066 NCBI36
  
AAGGAGCTCACTATCACGCCATCAT C → T GGGCAGCCCTGATGATGAAAATCCT
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
63
0
0
0.000
128
64
0
0
0.000
130
63
2
0
0.015
132
66
0
0
0.000
PMT-272
 PDE
74907421 GRCh37
74585069 NCBI36
  
GAGCTCACTATCACGCCATCATCGG G → T CAGCCCTGATGATGAAAATCCTCTG
+ 
 
n=
G/G=
G/T=
T/T=
T=
126
42
20
1
0.175
128
61
3
0
0.023
130
61
4
0
0.031
132
62
4
0
0.030
PMT-272
 PDE
74907489 GRCh37
74585137 NCBI36
  
TGGCCATTGCTCTCGGCTACAGGGC C → G GAGGATGCCCCAGCTAGTGGCCTAA
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
62
1
0
0.008
128
64
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDE9 pubsI
74907582 GRCh37
74585230 NCBI36
18521457
AGTGCCCACCCTGGGCTGGAGCTGT C → T TCCAAGCTGCATGGAGGCCTGCTCC
+486
Ser → Phe
(D=155)
n=
C/C=
C/T=
T/T=
T=
126
29
25
9
0.341
128
59
5
0
0.039
130
44
17
4
0.192
132
54
12
0
0.091
PMT-272
Exon 10: CodingPDE
74907721 GRCh37
74585369 NCBI36
19911596
TGGTCCAGGATGCTCTGGACAACAG C → T CAGGTGAGTCAGGCCTCTCGTGGCA
+532
Ser = Ser
n=
C/C=
C/T=
T/T=
T=
126
41
21
1
0.183
128
61
3
0
0.023
130
61
4
0
0.031
132
62
4
0
0.030
PMT-272
 PDE
74907816 GRCh37
74585464 NCBI36
  
GTCATACTCTCCACTTCTGCATGCT C → G TCACTCTGTAGCTCTCGTCTCTCTG
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
62
1
0
0.008
128
64
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74907822 GRCh37
74585470 NCBI36
  
CTCTCCACTTCTGCATGCTCTCACT C → G TGTAGCTCTCGTCTCTCTGTCTCTC
+ 
 
n=
C/C=
C/G=
G/G=
G=
126
63
0
0
0.000
128
64
0
0
0.000
130
64
1
0
0.008
132
66
0
0
0.000
PMT-272
 PDE
74907865 GRCh37
74585513 NCBI36
  
TGTCTCTCTCTGTTGGCAGATGTAG A → G ACATTATTCTCACAATAAGCTTTCA
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
63
0
0
0.000
128
64
0
0
0.000
130
37
24
4
0.246
132
66
0
0
0.000
PMT-272
 PDE
74907900 GRCh37
74585548 NCBI36
  
TCACAATAAGCTTTCACTGGCCAGG A → C GCAGTGGCTTATGCCTGTAATCCCA
+ 
 
n=
A/A=
A/C=
C/C=
C=
124
30
24
8
0.323
128
59
5
0
0.039
130
44
16
5
0.200
132
55
11
0
0.083
PMT-272
 PDE
74911179 GRCh37
74588827 NCBI36
  
TACCCCAACTGGCTGTGGAACTTGG G → A CCTCTCACAAGCCTTCCCCGCTGCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
65
1
0
0.008
134
67
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 11: CodingPDE
74911307 GRCh37
74588955 NCBI36
20331638
ACTGCAGCTGCGTGGTGGAGGGCAA C → A CCCGTGCTGGCAGGATCCTGCGACT
+546
Asn → Lys
(D=94)
n=
C/C=
C/A=
A/A=
A=
132
65
1
0
0.008
132
66
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 11: CodingPDE
74911397 GRCh37
74589045 NCBI36
21231728
TCAGCCTGGGCTCGGCCCTGGCCTG T → C CTCACCCACACACCCTCCTTCATGC
+576
Cys = Cys
n=
T/T=
T/C=
C/C=
C=
132
64
2
0
0.015
134
67
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74911555 GRCh37
74589203 NCBI36
  
CACTTGGGTGTCCTGGCCCCCACAA T → C ATGGCCTTAACTGTGTTCATCCCAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
61
3
1
0.038
134
67
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
 PDE
74914148 GRCh37
74591796 NCBI36
  
CAAGCTCATGGGGTGACAGACCTGG C → G CCAGCTCTCCTAGAGCGGGGTATAG
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
64
0
0
0.000
116
57
1
0
0.009
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
74914194 GRCh37
74591842 NCBI36
  
TATAGAGGCAGAGTCTAGACAGCCC G → A TCAGGAAGCCACCTCGGATGCAGGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
63
1
0
0.008
116
49
9
0
0.078
132
66
0
0
0.000
134
64
3
0
0.022
PMT-272
 PDE
74914313 GRCh37
74591961 NCBI36
  
TGCCAGGGAGGGGGCAGGGTAGGAC G → A GTGGGCCTTCATTGTCCCCTGAGCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
63
1
0
0.008
116
58
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
74914479 GRCh37
74592127 NCBI36
  
ATGACCTGCTCCGAAACCGGTGAGA C → T CTGGTTTGATGGCTTGTGGGAAGGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
63
1
0
0.008
116
58
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
74914518 GRCh37
74592166 NCBI36
  
TTGTGGGAAGGGTGCTGGAAATACT C → G TCAGAGTCCCAGGCAGGATACCAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
128
63
1
0
0.008
116
58
0
0
0.000
132
66
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 14: CodingPDE
74915586 GRCh37
74593234 NCBI36
24862091
CTGCCGTAGAGCAGCAATTGCTAGT G → A TCGGGGCCAGGGAAGAAGCCAGAGG
+697
Val = Val
n=
G/G=
G/A=
A/A=
A=
126
59
4
0
0.032
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74915643 GRCh37
74593291 NCBI36
2543 
GAGTGTGAGCTGTCTTGGGGCCCCA C → T CTGGCCAAGAGTAGCAGCCACAGCA
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
62
1
0
0.008
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74915767 GRCh37
74593415 NCBI36
2667 
TTGCTGTGTGACTTCAGGCAAGACA T → C TGATCCTCTCTCAGCCTTTGCTTGC
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
62
1
0
0.008
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74915876 GRCh37
74593524 NCBI36
2776 
GGGTCTTCTTCCTCCTTCCCCCAGC C → T AGCCAGCTGTCCTGGGGCCAGGCTT
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
63
0
0
0.000
126
63
0
0
0.000
132
65
1
0
0.008
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74916004 GRCh37
74593652 NCBI36
2904 
CATGCTGGGCCCCAGCCCAGGTCTG C → T ACTCGCCTGGATCACCTTCTTTGAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
62
1
0
0.008
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDEI
74916021 GRCh37
74593669 NCBI36
2921 
CAGGTCTGCACTCGCCTGGATCACC T → C TCTTTGAGCCTTAGCCATCTCCTGT
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
47
15
1
0.135
126
60
3
0
0.024
132
47
14
5
0.182
130
59
6
0
0.046
PMT-272
Exon 14: 3UTRPDE
74916099 GRCh37
74593747 NCBI36
2999 
AGGCTCGTTCAGCTATGACCATCTG T → G GCGGTCAGGGTACACTCAGCTCTCC
+ 
 
n=
T/T=
T/G=
G/G=
G=
126
63
0
0
0.000
126
63
0
0
0.000
132
66
0
0
0.000
130
64
1
0
0.008
PMT-272
Exon 14: 3UTRPDE
74916164 GRCh37
74593812 NCBI36
3064 
AGCCTTTAAGAAGTGTCCCTTTGGC G → A CCCCCTGGAGGCAGAGCACTGAGCT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
61
2
0
0.016
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74916282 GRCh37
74593930 NCBI36
3182 
GGGCCTTCAAGAGGCCTGTGTGGGG G → A CCCCAGGAATCCTTAGCTGAAGCGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
62
1
0
0.008
126
63
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74916664 GRCh37
74594312 NCBI36
3564 
AGTTCTGTGACACTGTTTTTTGGGG G → A TGGCACCTGGTTCTCCGATGCCTGG
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
66
1
0
0.007
132
66
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74916695 GRCh37
74594343 NCBI36
3595 
CCTGGTTCTCCGATGCCTGGGCTGG T → C GTCAGGCCCAGGACTGTAGTGCTGG
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
28
30
9
0.358
132
58
8
0
0.061
136
42
20
6
0.235
132
56
10
0
0.076
PMT-272
Exon 14: 3UTRPDE
74916726 GRCh37
74594374 NCBI36
3626 
GCCCAGGACTGTAGTGCTGGGAGCA G → A TAAAGCTCAGCTCTGTGTAATGAGT
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
65
1
0
0.008
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 14: 3UTRPDE
74916847 GRCh37
74594495 NCBI36
3747 
AGTCTTATCTGGCCTGGTTATTTCC T → C TGCGGGGAGGAGAGGGTTTGCTAAT
+ 
 
n=
T/T=
T/C=
C/C=
C=
134
27
29
11
0.381
132
58
8
0
0.061
136
42
20
6
0.235
132
54
12
0
0.091
PMT-272
Exon 14: 3UTRPDE
74916980 GRCh37
74594628 NCBI36
3880 
GGCTTCCTGGCCCTGTGCTGGGGGT G → C GGGGGAAGCTGGGGGCACATGTGGC
+ 
 
n=
G/G=
G/C=
C/C=
C=
134
67
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 14: 3UTRPDEI
74917011 GRCh37
74594659 NCBI36
3911 
AAGCTGGGGGCACATGTGGCCCTTG C → T CTTCTGAGCAGCTCCCAGTGCCAGG
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
55
11
1
0.097
132
63
3
0
0.023
136
47
16
5
0.191
132
60
6
0
0.045
PMT-272
Exon 14: 3UTRPDE
74917157 GRCh37
74594805 NCBI36
4057 
AATATCTGAGCATGTATCTATCAAC G → A CCAAGAATTTCAAAGTCTCCTTCAA
+ 
 
n=
G/G=
G/A=
A/A=
A=
134
67
0
0
0.000
132
66
0
0
0.000
136
66
2
0
0.015
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.