UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPD
HGNC Symbol:SLCO3A1
HGNC Description:solute carrier organic anion transporter family, member 3A1
HGNC ID:10952
Superfamily:SLC
Chromosome:Chr.15(+): 92396938-92715665 GRCh37
Location:15q26
OMIM:612435
OMIM Phenotype:None
Accessions:NM_013272
Nucleotide RefSeq:NM_013272
Protein RefSeq:NP_037404
Entrez:28232
Ensembl:ENSG00000176463
Isoforms:5
Evidence:Substrate In Vitro Evidence: estrone-3-sulfate BBA4 HEK293 benzylpenicillin BBA4 HEK293 prostaglandine E2 BBA4 HEK293 Tissue Distribution Evidence: ubiqitously BBA4 RT-PCR
Tissues:ubiqitously
Type:protein-coding
Sets:IV
PharmGKB ID:PA35837
HPRD ID:07502
Substrates:estrone-3-sulfate, benzylpenicillin, prostaglandine E2
Trivial Names:OATPD, OATP-D, OATP3A1, SLC21A11
Transcripts:NM_013272.3 [Chr.15(+): 92396938-92709137 GRCh37]
NM_001145044.1 [Chr.15(+): 92396938-92715665 GRCh37]
XM_005254889.1 [Chr.15(+): 92397049-92709133 GRCh37]
XM_005254891.1 [Chr.15(+): 92397541-92709133 GRCh37]
XM_005254890.1 [Chr.15(+): 92397565-92709133 GRCh37]
ENST00000318445 [Chr.15(+): 92396925-92709133 GRCh37]
ENST00000424469 [Chr.15(+): 92397086-92715665 GRCh37]
ENST00000553304 [Chr.15(+): 92397351-92459608 GRCh37]
ENST00000553653 [Chr.15(+): 92396953-92694446 GRCh37]
ENST00000555111 [Chr.15(+): 92397255-92451989 GRCh37]
ENST00000555210 [Chr.15(+): 92669416-92706176 GRCh37]
ENST00000555513 [Chr.15(+): 92696793-92706438 GRCh37]
ENST00000555549 [Chr.15(+): 92641160-92706776 GRCh37]
ENST00000555769 [Chr.15(+): 92397566-92698499 GRCh37]
ENST00000555892 [Chr.15(+): 92669414-92715077 GRCh37]
ENST00000556649 [Chr.15(+): 92484548-92647767 GRCh37]
ENST00000564072 [Chr.15(+): 92704805-92706776 GRCh37]
ENST00000566477 [Chr.15(+): 92714102-92715665 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO3A1.

Variant Data

View all PMT variants for SLCO3A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO3A1 RESEQUENCING  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO3A1 RESEQUENCING
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
92396782 GRCh37
90197786 NCBI36
-156-357
GGGGGTGAGAGCAGGCGCGGCCGGC G → A GGCAAGGGGAACCGGGCGATGGCAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
96
48
0
0
0.000
70
34
1
0
0.014
126
63
0
0
0.000
90
45
0
0
0.000
PMT-272
PromoterPDE
92396791 GRCh37
90197795 NCBI36
-147-348
AGCAGGCGCGGCCGGCGGGCAAGGG G → A AACCGGGCGATGGCAGCGGCGGGCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
96
48
0
0
0.000
70
33
2
0
0.029
126
63
0
0
0.000
90
45
0
0
0.000
PMT-272
PromoterPDE
92396935 GRCh37
90197939 NCBI36
-3-204
GGAGGCGGGGGAGGAGGAGGAGGAA G → T GGGCGATCGCGGCGGCGGCGGCGGC
+ 
 
n=
G/G=
G/T=
T/T=
T=
128
63
1
0
0.008
126
63
0
0
0.000
128
64
0
0
0.000
126
63
0
0
0.000
PMT-272
Promoter
Exon 1: 5UTR
PDE
92396940 GRCh37
90197944 NCBI36
3-199
CGGGGGAGGAGGAGGAGGAAGGGGC G → GGCG ATCGCGGCGGCGGCGGCGGCGGCGA
+ 
 
n=
G/G=
G/GGCG=
GGCG/GGCG=
GGCG=
130
48
17
0
0.131
126
35
28
0
0.222
128
63
1
0
0.008
128
46
18
0
0.141
PMT-272
Promoter
Exon 1: 5UTR
PDE
92396944 GRCh37
90197948 NCBI36
7-195
GGAGGAGGAGGAGGAAGGGGCGATC GCGGCGGCG → - GCGGCGGCGGCGAGGAG
+ 
 
n=
GCGGCGGCG/GCGGCGGCG=
GCGGCGGCG/-=
-/-=
-=
130
64
1
0
0.008
126
63
0
0
0.000
128
64
0
0
0.000
128
63
1
0
0.008
PMT-272
Exon 4: CodingPDE
92647531 GRCh37
90448535 NCBI36
969768
CAGGTAACCTGGACATCACTCCGGA C → T GACCCCCGCTGGATCGGAGCCTGGT
+256
Asp = Asp
n=
C/C=
C/T=
T/T=
T=
132
64
2
0
0.015
130
65
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
Exon 4: CodingPDE
92647633 GRCh37
90448637 NCBI36
1071870
TGTTTGGGTTTCCACAGTCCCTGCC C → T CCGCACTCAGAGCCCGCCATGGAAA
+290
Pro = Pro
n=
C/C=
C/T=
T/T=
T=
132
66
0
0
0.000
130
65
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 4: CodingPDE1 pub
92647645 GRCh37
90448649 NCBI36
1083882
CACAGTCCCTGCCCCCGCACTCAGA G → C CCCGCCATGGAAAGCGAGCAGGCCA
+294
Glu → Asp
(D=45)
n=
G/G=
G/C=
C/C=
C=
132
0
14
52
0.894
130
4
19
42
0.792
136
1
3
64
0.963
134
0
11
56
0.918
PMT-272
Exon 4: CodingPDE
92647684 GRCh37
90448688 NCBI36
1122921
GCGAGCAGGCCATGCTCTCCGAAAG A → C GAATACGAGAGACCCAAGCCCAGCA
+307
Arg → Ser
(D=110)
n=
A/A=
A/C=
C/C=
C=
132
66
0
0
0.000
130
63
2
0
0.015
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDEI
92647834 GRCh37
90448838 NCBI36
  
AGGGGGATTGGGATGGGGGTGATGA A → G TGAAGGGGTGGCACCCAGGACTGGG
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
8
23
35
0.705
130
5
28
32
0.708
136
12
34
22
0.574
134
0
17
50
0.873
PMT-272
 PDE
92647851 GRCh37
90448855 NCBI36
  
GGTGATGAATGAAGGGGTGGCACCC A → G GGACTGGGGTGCTTGGGGACTTGGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
132
66
0
0
0.000
130
64
1
0
0.008
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDEI
92663630 GRCh37
90464634 NCBI36
  
CCAAGAAGGGGCCTTAGGAGCAGGG A → G GCTATAAGATGGGAGCACAGGGTGT
+ 
 
n=
A/A=
A/G=
G/G=
G=
130
4
21
40
0.777
134
1
5
61
0.948
136
25
32
11
0.397
134
3
27
37
0.754
PMT-272
 PDE
92663905 GRCh37
90464909 NCBI36
  
CCTGAGAGGGTCGGGGGAGGGTGTC C → T TGTGTGTAAGGCACTAAAAATTTAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
61
4
0
0.031
134
67
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
92664048 GRCh37
90465052 NCBI36
  
GAGTAAGATTTGCCTGCCTGGATCA G → A TTGCTAAAAGCACATGATAATAAAG
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
46
18
1
0.154
134
67
0
0
0.000
136
68
0
0
0.000
134
65
2
0
0.015
PMT-272
 PDE
92669029 GRCh37
90470033 NCBI36
  
TCTTCAGCTTGCGTTTCTCCTGAGG G → T TGCCCCACTTAGCAGGACAGGTGCG
+ 
 
n=
G/G=
G/T=
T/T=
T=
128
63
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
92669105 GRCh37
90470109 NCBI36
  
TGCTTTATGTCTGTCTCCCCCAGTT C → T TCCATGAGCTCCCTGGGGGCATAAA
+ 
 
n=
C/C=
C/T=
T/T=
T=
128
63
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
130
64
1
0
0.008
PMT-272
 PDEI
92669184 GRCh37
90470188 NCBI36
  
CCATGGAGGCAGTGACACCACAGTG G → A GGTCATAGGGCATTCACGGGACTCA
+ 
 
n=
G/G=
G/A=
A/A=
A=
128
8
33
23
0.617
132
56
8
2
0.091
136
13
28
27
0.603
130
38
22
5
0.246
PMT-272
 PDE
92669584 GRCh37
90470588 NCBI36
  
TTGAGGGAACCAGCTTTGTTCCTAG T → C GACCTGAGGAGACGCATCACGGCTG
+ 
 
n=
T/T=
T/C=
C/C=
C=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
92669598 GRCh37
90470602 NCBI36
  
TTTGTTCCTAGTGACCTGAGGAGAC G → A CATCACGGCTGCCTCTGCATCTTAC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDE
92669599 GRCh37
90470603 NCBI36
  
TTGTTCCTAGTGACCTGAGGAGACG C → T ATCACGGCTGCCTCTGCATCTTACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
63
2
0
0.015
132
66
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
92671535 GRCh37
90472539 NCBI36
  
GCTGTCACTGGGGGCATCTGATTCC G → A AATTGACCTGTTTCTAATGGCTTCC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
64
1
0
0.008
132
66
0
0
0.000
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
 PDE
92671560 GRCh37
90472564 NCBI36
  
GAATTGACCTGTTTCTAATGGCTTC C → T GTGTTTCCTTTCTTTTCCAGCACAG
+ 
 
n=
C/C=
C/T=
T/T=
T=
130
65
0
0
0.000
132
66
0
0
0.000
136
66
2
0
0.015
134
67
0
0
0.000
PMT-272
 PDE
92671726 GRCh37
90472730 NCBI36
  
TGCTGGCTGCAACAGCACGGTAATG G → C GATGGGGCAGGGGATGGGGCAGGGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
65
0
0
0.000
132
66
0
0
0.000
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
 PDE
92671734 GRCh37
90472738 NCBI36
  
GCAACAGCACGGTAATGGGATGGGG CAGGGGATGGGG → - CAGGGGATTCAGGC
+ 
 
n=
CAGGGGATGGGG/CAGGGGATGGGG=
CAGGGGATGGGG/-=
-/-=
-=
130
46
19
0
0.146
132
65
1
0
0.008
136
68
0
0
0.000
134
65
2
0
0.015
PMT-272
 PDE
92671745 GRCh37
90472749 NCBI36
  
GTAATGGGATGGGGCAGGGGATGGG G → C CAGGGGATTCAGGCAGCTAAAGTGG
+ 
 
n=
G/G=
G/C=
C/C=
C=
92
45
0
1
0.022
130
57
8
0
0.062
136
62
6
0
0.044
130
37
24
4
0.246
PMT-272
 PDE
92671801 GRCh37
90472805 NCBI36
  
AACCCAAGTTTTTGCCCAGGTTGTT C → T GCCTTCCCTGTGACTTTTTCTTAGC
+ 
 
n=
C/C=
C/T=
T/T=
T=
92
42
4
0
0.043
130
65
0
0
0.000
136
68
0
0
0.000
130
65
0
0
0.000
PMT-272
 PDEI
92671919 GRCh37
90472923 NCBI36
  
AAATCAAGTGGGTTTGTAGGAAGTC T → C CATTGTGCAACTGAAAGTAAAAATT
+ 
 
n=
T/T=
T/C=
C/C=
C=
92
14
23
9
0.446
130
21
31
13
0.438
136
11
35
22
0.581
130
35
19
11
0.315
PMT-272
 PDE
92694148 GRCh37
90495152 NCBI36
  
TTACAGGGGAATGATAAAAATCTGG TTTT → - TTTTTTCTCTTCATCTCTTTGC
+ 
 
n=
TTTT/TTTT=
TTTT/-=
-/-=
-=
110
54
1
0
0.009
124
62
0
0
0.000
126
63
0
0
0.000
124
62
0
0
0.000
PMT-272
 PDE
92694174 GRCh37
90495178 NCBI36
  
TTTTTTTTTCTCTTCATCTCTTTGC A → G CGTAGGACAGTCAGCCCTGAACTCA
+ 
 
n=
A/A=
A/G=
G/G=
G=
108
49
5
0
0.046
124
62
0
0
0.000
126
63
0
0
0.000
124
62
0
0
0.000
PMT-272
Exon 9: CodingPDEIA
92694207 GRCh37
90495211 NCBI36
19171716
CAGTCAGCCCTGAACTCAAGTCTTA C → T GCTTTGGGAGTTCTTTTTCTCCTCC
+572
Tyr = Tyr
n=
C/C=
C/T=
T/T=
T=
108
52
2
0
0.019
124
62
0
0
0.000
126
34
26
3
0.254
124
56
6
0
0.048
PMT-272
Exon 10: CodingPDE
92706099 GRCh37
90507103 NCBI36
20681867
CGTCCTCTACGACAATGTGGTCTAC C → A GATACCTGTATGTCAGCATCGCCAT
+623
Arg = Arg
n=
C/C=
C/A=
A/A=
A=
126
62
1
0
0.008
128
64
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDE
92706147 GRCh37
90507151 NCBI36
21161915
CATCGCGCTCAAATCCTTCGCCTTC A → T TCCTGTACACCACCACGTGGCAGTG
+639
Ile → Phe
(D=21)
n=
A/A=
A/T=
T/T=
T=
126
62
1
0
0.008
128
64
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDE
92706164 GRCh37
90507168 NCBI36
21331932
TCGCCTTCATCCTGTACACCACCAC G → A TGGCAGTGCCTGAGGAAAAACTATA
+644
Thr = Thr
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
128
63
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: CodingPDE
92706215 GRCh37
90507219 NCBI36
21841983
AACGCTACATCAAAAACCACGAGGG C → T GGGCTGAGCACCAGTGAGTTCTTTG
+661
Gly = Gly
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
128
64
0
0
0.000
134
67
0
0
0.000
132
65
1
0
0.008
PMT-272
Exon 10: CodingPDE
92706365 GRCh37
90507369 NCBI36
23342133
GTGAAAACATGGAGTCCGTTTTATA G → T TGACTAAAGGAGGGCTGAACTCTGT
+ 
STOP → Tyr
n=
G/G=
G/T=
T/T=
T=
124
62
0
0
0.000
128
64
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
92706375 GRCh37
90507379 NCBI36
2344 
GGAGTCCGTTTTATAGTGACTAAAG G → A AGGGCTGAACTCTGTATTAGTAATC
+ 
 
n=
G/G=
G/A=
A/A=
A=
124
61
1
0
0.008
128
64
0
0
0.000
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
92706489 GRCh37
90507493 NCBI36
2458 
CACACACAGGCACAGATGCACACAC A → G CGCAGACAGACACACCGACTTTGTC
+ 
 
n=
A/A=
A/G=
G/G=
G=
124
62
0
0
0.000
128
63
1
0
0.008
134
67
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDE
92706568 GRCh37
90507572 NCBI36
2537 
ATTCAGAATAAGGAGAGAATGACAT C → T GTGCGGCAGGGTCCTGGAGGCCACT
+ 
 
n=
C/C=
C/T=
T/T=
T=
124
62
0
0
0.000
128
64
0
0
0.000
134
66
1
0
0.007
132
66
0
0
0.000
PMT-272
Exon 10: 3UTRPDEI
92706594 GRCh37
90507598 NCBI36
2563 
GTGCGGCAGGGTCCTGGAGGCCACT T → C GCGCGGCTGGGCCACAGAGTCTACT
+ 
 
n=
T/T=
T/C=
C/C=
C=
124
9
24
29
0.661
128
8
30
26
0.641
134
35
25
7
0.291
132
11
28
27
0.621
PMT-272
Exon 10: 3UTRPDE
92706643 GRCh37
90507647 NCBI36
2612 
CTTTGAAGGCACCTCATGGTTTTCA G → T GATGCTGACAGCTGCAAGCAACAGG
+ 
 
n=
G/G=
G/T=
T/T=
T=
122
56
5
0
0.041
128
63
1
0
0.008
132
66
0
0
0.000
132
64
2
0
0.015
PMT-272
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.