UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPH
HGNC Symbol:SLCO4C1
HGNC Description:solute carrier organic anion transporter family, member 4C1
HGNC ID:23612
Superfamily:SLC
Chromosome:Chr.5(-): 101569690-101632253 GRCh37
Location:5q21.2
OMIM:609013
OMIM Phenotype:None
Accessions:NM_180991
Nucleotide RefSeq:NM_180991
Protein RefSeq:NP_851322
Entrez:353189
Ensembl:ENSG00000173930
Isoforms:1
Evidence:None
Tissues:None
Type:protein-coding
Sets:V
PharmGKB ID:PA134892408
HPRD ID:12354
Substrates:None
Trivial Names:OATPX, OATP-H, OATP-M1, OATP4C1, PRO2176, SLC21A20
Transcripts:NM_180991.4 [Chr.5(-): 101569690-101632253 GRCh37]
ENST00000310954 [Chr.5(-): 101569690-101632253 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO4C1.

Variant Data

View all PMT variants for SLCO4C1 on UCSC Genome Browser
Showing SNP features for transcript: NM_180991  
SLCO4C1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO4C1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
101632506 GRCh37
101660405 NCBI36
-253-540
TTGTTCAGGAAACTATCTTGCGTTT T → TT CTTCCTTTGCTGCTTACCAAAGCAG
+ 
 
n=
T/T=
T/TT=
TT/TT=
TT=
134
29
29
9
0.351
134
8
35
24
0.619
132
25
23
18
0.447
132
18
32
16
0.485
PMT-272
PromoterPDE
101632467 GRCh37
101660366 NCBI36
-214-501
GGTGCTGACATGAAACCTGTAAACA G → T TTGCATCAGGAGATTGTTCAGGAAA
+ 
 
n=
G/G=
G/T=
T/T=
T=
134
63
4
0
0.030
134
41
22
4
0.224
132
66
0
0
0.000
132
58
8
0
0.061
PMT-272
PromoterPDE
101632375 GRCh37
101660274 NCBI36
-122-409
CCTGAGCCTTCAGCCCGCAGCGCGC C → T TCCCTTGAGCCCAAGCACTGGGAAC
+ 
 
n=
C/C=
C/T=
T/T=
T=
134
34
26
7
0.299
134
30
25
12
0.366
132
32
24
10
0.333
132
29
27
10
0.356
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.