UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPJ
HGNC Symbol:SLCO5A1
HGNC Description:solute carrier organic anion transporter family, member 5A1
HGNC ID:19046
Superfamily:SLC
Chromosome:Chr.8(-): 70584110-70747299 GRCh37
Location:8q13.3
OMIM:613543
OMIM Phenotype:None
Accessions:NM_030958
Nucleotide RefSeq:NM_030958
Protein RefSeq:NP_112220
Entrez:81796
Ensembl:ENSG00000137571
Isoforms:5
Evidence:None
Tissues:not known
Type:protein-coding
Sets:V
PharmGKB ID:PA134948571
HPRD ID:15399
Substrates:not known
Trivial Names:OATP-J, OATP5A1, OATPRP4, OATP-RP4, SLC21A15
Transcripts:NM_030958.2 [Chr.8(-): 70584568-70747299 GRCh37]
NM_001146008.1 [Chr.8(-): 70584568-70745625 GRCh37]
NM_001146009.1 [Chr.8(-): 70584568-70745404 GRCh37]
XM_005251313.1 [Chr.8(-): 70584110-70747299 GRCh37]
XM_005251314.1 [Chr.8(-): 70584110-70685207 GRCh37]
ENST00000260126 [Chr.8(-): 70579282-70747299 GRCh37]
ENST00000524703 [Chr.8(-): 70744919-70746460 GRCh37]
ENST00000524945 [Chr.8(-): 70584578-70745625 GRCh37]
ENST00000526750 [Chr.8(-): 70584788-70747094 GRCh37]
ENST00000528658 [Chr.8(-): 70673600-70747201 GRCh37]
ENST00000530307 [Chr.8(-): 70584898-70744950 GRCh37]
ENST00000531422 [Chr.8(-): 70744958-70745863 GRCh37]
ENST00000532388 [Chr.8(-): 70617127-70746244 GRCh37]
Annotation History:View Events (19)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO5A1.

Variant Data

View all PMT variants for SLCO5A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO5A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO5A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDE
70747438 GRCh37
70909992 NCBI36
-139-2530
CCAAGAGCGCTGAAGCCCCGAGGGA G → C CCGGTCTCTAGAAAAGTCAGCGGCT
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
66
0
0
0.000
132
66
0
0
0.000
130
65
0
0
0.000
132
64
2
0
0.015
PMT-272
PromoterPDE
70747414 GRCh37
70909968 NCBI36
-115-2506
CTTCACCTGCGTGGCTGCGGGGGCC C → G AAGAGCGCTGAAGCCCCGAGGGAGC
+ 
 
n=
C/C=
C/G=
G/G=
G=
132
59
6
1
0.061
132
65
1
0
0.008
130
62
3
0
0.023
132
63
3
0
0.023
PMT-272
PromoterPDE
70747355 GRCh37
70909909 NCBI36
-56-2447
GCGCAGGCGCGAGGGCAGCCACCCA G → C CCCAGCCCTCCCACAGCCAGCCACC
+ 
 
n=
G/G=
G/C=
C/C=
C=
132
53
13
0
0.098
132
66
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272
PromoterPDE
70747313 GRCh37
70909867 NCBI36
-14-2405
ACACACGCGCACAGAGACGCGCCCG G → A AGAGGAGCAGCCGAGGGCGCAGGCG
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
62
4
0
0.030
132
66
0
0
0.000
130
65
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
PDE
70747296 GRCh37
70909850 NCBI36
4-2388
TCCTCCGCTCCAAACAGACACACGC G → A CACAGAGACGCGCCCGGAGAGGAGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
132
66
0
0
0.000
132
66
0
0
0.000
130
62
3
0
0.023
132
66
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.