UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:OATPY
HGNC Symbol:SLCO6A1
HGNC Description:solute carrier organic anion transporter family, member 6A1
HGNC ID:23613
Superfamily:SLC
Chromosome:Chr.5(-): 101707492-101834720 GRCh37
Location:5q21.1
OMIM:613365
OMIM Phenotype:None
Accessions:NM_173488
Nucleotide RefSeq:NM_173488
Protein RefSeq:NP_775759
Entrez:133482
Ensembl:ENSG00000205359
Isoforms:6
Evidence:None
Tissues:None
Type:protein-coding
Sets:V
PharmGKB ID:PA134949852
HPRD ID:15400
Substrates:None
Trivial Names:GST, CT48, OATPY, OATP6A1
Transcripts:NM_173488.3 [Chr.5(-): 101707651-101834720 GRCh37]
XM_005271874.1 [Chr.5(-): 101707492-101834720 GRCh37]
XM_005271875.1 [Chr.5(-): 101707616-101834720 GRCh37]
XM_005271877.1 [Chr.5(-): 101707618-101834720 GRCh37]
XM_005271876.1 [Chr.5(-): 101707649-101834720 GRCh37]
XM_005271873.1 [Chr.5(-): 101707649-101834720 GRCh37]
ENST00000379807 [Chr.5(-): 101707649-101834683 GRCh37]
ENST00000379810 [Chr.5(-): 101707654-101834720 GRCh37]
ENST00000389019 [Chr.5(-): 101707649-101834720 GRCh37]
ENST00000505407 [Chr.5(-): 101811426-101834514 GRCh37]
ENST00000505739 [Chr.5(-): 101774245-101813401 GRCh37]
ENST00000506729 [Chr.5(-): 101707486-101834720 GRCh37]
ENST00000511588 [Chr.5(-): 101707492-101709133 GRCh37]
ENST00000513675 [Chr.5(-): 101707650-101834617 GRCh37]
ENST00000514551 [Chr.5(-): 101755627-101834354 GRCh37]
ENST00000514765 [Chr.5(-): 101707649-101726933 GRCh37]
Annotation History:View Events (45)

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for SLCO6A1.

Variant Data

View all PMT variants for SLCO6A1 on UCSC Genome Browser
Showing SNP features for transcript:   
SLCO6A1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:SLCO6A1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 
101834992 GRCh37
101862891 NCBI36
-272-444
CCAGGAGAGAGCAGAAGACATTAAA A → ACAA CAACAACAACAACAACAACAACAAA
+ 
 
n=
A/A=
A/ACAA=
ACAA/ACAA=
ACAA=
130
21
43
1
0.346
130
13
52
0
0.400
134
29
36
2
0.299
134
14
49
4
0.425
PMT-272
PromoterPDE
101834767 GRCh37
101862666 NCBI36
-47-219
TTGAGAACTTCCAAAGCTGTTTTCC T → A TCTTTTCTTCCACGTGCGGAAGGAA
+ 
 
n=
T/T=
T/A=
A/A=
A=
130
64
1
0
0.008
134
59
8
0
0.060
136
68
0
0
0.000
134
67
0
0
0.000
PMT-272
PromoterPDE
101834729 GRCh37
101862628 NCBI36
-9-181
CTAGGGCAGGAGGCAAACGTCCTCC C → CA GGGGGTTGACGGTTGAGAACTTCCA
+ 
 
n=
C/C=
C/CA=
CA/CA=
CA=
130
65
0
0
0.000
134
67
0
0
0.000
136
68
0
0
0.000
134
63
2
2
0.045
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.