UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:TAP1
HGNC Symbol:TAP1
HGNC Description:transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
HGNC ID:43
Superfamily:ABC
Chromosome:Chr.6(-): 32812986-32821748 GRCh37
Location:6p21.3
OMIM:170260
OMIM Phenotype:Peptide transporter psf1 polymorhpism; Tap1 deficiency, somatic
Accessions:BC014081
Nucleotide RefSeq:NM_000593
Protein RefSeq:NP_000584
Entrez:6890
Ensembl:ENSG00000168394
Isoforms:9
Evidence:None
Tissues:T-lymphocytes
Type:protein-coding
Sets:0
PharmGKB ID:PA35021
HPRD ID:01359
Substrates:Cytosolic peptides
Trivial Names:APT1, PSF1, ABC17, ABCB2, PSF-1, RING4, TAP1N, D6S114E, TAP1*0102N
Transcripts:NM_000593.5 [Chr.6(-): 32812986-32821748 GRCh37]
XM_005249331.1 [Chr.6(-): 32812986-32820559 GRCh37]
XM_005274883.1 [Chr.6(-): 4099989-4107563 GRCh37]
XM_005272862.1 [Chr.6(-): 4257514-4265087 GRCh37]
XM_005275014.1 [Chr.6(-): 4094364-4101937 GRCh37]
XM_005275153.1 [Chr.6(-): 4270182-4277755 GRCh37]
XM_005275284.1 [Chr.6(-): 4149862-4157436 GRCh37]
XM_005275446.1 [Chr.6(-): 4045093-4052666 GRCh37]
XM_005275585.1 [Chr.6(-): 4243759-4251332 GRCh37]
ENST00000354258 [Chr.6(-): 32812986-32821755 GRCh37]
ENST00000425148 [Chr.6(-): 32812987-32820535 GRCh37]
ENST00000486332 [Chr.6(-): 32812986-32817919 GRCh37]
ENST00000487296 [Chr.6(-): 32813452-32816007 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for TAP1.

Variant Data

View all PMT variants for TAP1 on UCSC Genome Browser
Showing SNP features for transcript:   
TAP1 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:TAP1 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
 PDE
32822086 GRCh37
32930064 NCBI36
-338-493
ACCGGGGTAATGGGTCTGGGCTTGA G → C GGTTGGCAGAGGGGTGGAGGAGATG
+ 
 
n=
G/G=
G/C=
C/C=
C=
130
63
2
0
0.015
134
67
0
0
0.000
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
 
32822032 GRCh37
32930010 NCBI36
-284-439
ATGCTGCGGGCGGGAGCACCAACCG G → A GGACTTACCCCGGGCGGGAGAAGTC
+ 
 
n=
G/G=
G/A=
A/A=
A=
130
62
3
0
0.023
134
67
0
0
0.000
136
67
1
0
0.007
132
66
0
0
0.000
PMT-272
PromoterPDE
32821868 GRCh37
32929846 NCBI36
-120-275
AGATCTGCCCTACACACGTTAGCGC C → A GCGCGCAAAGCAGCCCCGCAGCACC
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
63
2
0
0.015
134
66
1
0
0.007
136
68
0
0
0.000
132
63
3
0
0.023
PMT-272
PromoterPDE1 pub
32821859 GRCh37
32929837 NCBI36
-111-266
TCTCGGGGCAGATCTGCCCTACACA C → A GTTAGCGCCGCGCGCAAAGCAGCCC
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
15
37
13
0.485
134
20
39
8
0.410
136
27
23
18
0.434
132
20
33
13
0.447
PMT-272
Promoter
32821760 GRCh37
32929738 NCBI36
-12-167
TCCATCACGCACACCCTTCTCGCCT C → A TCCCTGCCTCCTGCCTTTCCACTTG
+ 
 
n=
C/C=
C/A=
A/A=
A=
130
65
0
0
0.000
134
66
1
0
0.007
136
68
0
0
0.000
132
66
0
0
0.000
PMT-272
Exon 1: 5UTR
Promoter
32821709 GRCh37
32929687 NCBI36
40-116
CGTGGAAATCAGATCTGAGAATCTC G → - GGAGCAGCCCTGGTGCCCAATTTTC
+ 
 
n=
G/G=
G/-=
-/-=
-=
130
65
0
0
0.000
134
66
1
0
0.007
136
60
8
0
0.059
132
55
11
0
0.083
PMT-272
Exon 1: 5UTRPDE
32821675 GRCh37
32929653 NCBI36
74-82
AAAAGTGGCCTGCCCAGACTATTTT G → - GTAGCAAGCGTGGAAATCAGATCTG
+ 
 
n=
G/G=
G/-=
-/-=
-=
130
64
1
0
0.008
132
66
0
0
0.000
122
61
0
0
0.000
110
55
0
0
0.000
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.