UCSF Pharmacogenetics of Membrane Transporters
Gene View
Common Name:TAP2
HGNC Symbol:TAP2
HGNC Description:transporter 2, ATP-binding cassette, sub-family B (MDR/TAP)
HGNC ID:44
Superfamily:ABC
Chromosome:Chr.6(-): 32789610-32806547 GRCh37
Location:6p21.3
OMIM:170261
OMIM Phenotype:Peptide transporter psf2 polymorphism; Bare lymphocyte syndrome, type 1; Wegener-like granulomatosis
Accessions:M74447,X87344
Nucleotide RefSeq:NM_000544
Protein RefSeq:NP_000535
Entrez:6891
Ensembl:ENSG00000204267
Isoforms:13
Evidence:Substrate In Vitro Evidence: MHC class I peptides (8-12 amino acids) 1. Review article. Abele R and Tampe R. Biochim Biophys Acta. 1999 Dec 6;1461(2):405-19. Tissue Distribution Evidence: Lung > Spleen, Trachea > Thymus, Utereus, Small intestine, Prostate - TaqMan RT-PCR. Langmann T, et al. Clinical Chemistry. 2003; 49: 230-8.
Tissues:Lung > Spleen, Trachea > Thymus, Utereus, Small intestine, Prostate
Type:protein-coding
Sets:0
PharmGKB ID:PA35022
HPRD ID:01360
Substrates:MHC class I peptides (8-12 amino acids)
Trivial Names:APT2, PSF2, ABC18, ABCB3, PSF-2, RING11, D6S217E
Transcripts:NM_000544.3 [Chr.6(-): 32793187-32806547 GRCh37]
NM_018833.2 [Chr.6(-): 32789610-32806547 GRCh37]
XM_005249332.1 [Chr.6(-): 32790066-32806349 GRCh37]
XM_005274885.1 [Chr.6(-): 4077026-4093239 GRCh37]
XM_005274884.1 [Chr.6(-): 4080364-4093239 GRCh37]
XM_005272863.1 [Chr.6(-): 4234596-4250877 GRCh37]
XM_005275016.1 [Chr.6(-): 4071399-4087613 GRCh37]
XM_005275015.1 [Chr.6(-): 4076644-4087613 GRCh37]
XM_005275154.1 [Chr.6(-): 4247262-4263429 GRCh37]
XM_005275285.1 [Chr.6(-): 4126766-4143112 GRCh37]
XM_005275447.1 [Chr.6(-): 4022173-4038340 GRCh37]
XM_005275587.1 [Chr.6(-): 4220796-4237009 GRCh37]
XM_005275586.1 [Chr.6(-): 4224134-4237009 GRCh37]
ENST00000452392 [Chr.6(-): 32781544-32806599 GRCh37]

GTEx Expression by Gene and Transcript

The heat map summarizes relative expression by tissue type at two levels of tissue detail, e.g., 'Brain' and 'Brain - Amygdala'. Choose among four calculated expression values, including mean and median RPKM values, and quantile normalized (QN) distributions of these values. (Note that differences between some distributions are subtle.) The coloring is relative to the mean of all displayed values. All values are log base 2. (See also PMT GTEx Expression Plotting.) Click on a transcript or tissue to resort the data.

Tissues:
Expression values:
No expression data exists for TAP2.

Variant Data

View all PMT variants for TAP2 on UCSC Genome Browser
Showing SNP features for transcript:   
TAP2 Resequencing  
1000 Genomes  
[Your browser is not displaying the SVG image of experimental data in gene context.]
Study Name:TAP2 Resequencing
Experiments:
PMT impact: P - Public  D - Discovered  E - Exclusive  (dbSNP build 142)
Array availability: I - found on Illumina Human1M-Duo BeadChip (2011-04-21)  A - found on Affymetrix Genome-Wide SNP Array 6.0 (2011-06-21)  
Download the SNP table data as a tab-delimited file.
FeaturePMT IDdbSNP/ PubMedArray AvailabilityGenomic PositionTranscript PositionCoding PositionNucleotide ChangeStrandAmino Acid PositionAmino Acid ChangeStatisticsAA FreqCA FreqAS FreqME FreqSample Set
PromoterPDEI
32806786 GRCh37
32914764 NCBI36
-239-776
AAATACAGTTGTCTCAAGGGCAACT T → G TATCTGTTGTCCTTGCTTTGTAATT
+ 
 
n=
T/T=
T/G=
G/G=
G=
126
22
31
10
0.405
130
17
38
10
0.446
136
22
34
12
0.426
134
23
33
11
0.410
PMT-272
PromoterPDE
32806673 GRCh37
32914651 NCBI36
-126-663
CTGGAGCCCGAACTCTGGTTCGCAC T → C GTACAGGCCTGCAATGAGTCTCACT
+ 
 
n=
T/T=
T/C=
C/C=
C=
126
62
1
0
0.008
130
62
3
0
0.023
136
61
6
1
0.059
134
67
0
0
0.000
PMT-272
PromoterPDEI
32806584 GRCh37
32914562 NCBI36
-37-574
GGCAGCTTTCGCTTTCGCTTCCCCA G → A CCAAGGCCTTCATTCTGGGCTGGGC
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
19
34
10
0.429
130
16
37
12
0.469
136
21
35
12
0.434
134
24
33
10
0.396
PMT-272
Promoter
32806578 GRCh37
32914556 NCBI36
-31-568
GGCTCGGGCAGCTTTCGCTTTCGCT T → TTCGCTT CCCCAGCCAAGGCCTTCATTCTGGG
+ 
 
n=
T/T=
T/TTCGCTT=
TTCGCTT/TTCGCTT=
TTCGCTT=
126
63
0
0
0.000
130
65
0
0
0.000
136
65
3
0
0.022
134
67
0
0
0.000
PMT-272
PromoterPDE
32806576 GRCh37
32914554 NCBI36
-29-566
AGGGCTCGGGCAGCTTTCGCTTTCG C → T TTCCCCAGCCAAGGCCTTCATTCTG
+ 
 
n=
C/C=
C/T=
T/T=
T=
126
21
32
10
0.413
130
16
39
10
0.454
136
22
34
12
0.426
134
23
33
11
0.410
PMT-272
PromoterPDE
32806553 GRCh37
32914531 NCBI36
-6-543
TACGCTCGGCCAGGGCGGGCGTCAG G → A GCTCGGGCAGCTTTCGCTTTCGCTT
+ 
 
n=
G/G=
G/A=
A/A=
A=
126
63
0
0
0.000
130
63
2
0
0.015
136
68
0
0
0.000
134
66
1
0
0.007
PMT-272
Exon 1: 5UTRPDE
32806461 GRCh37
32914439 NCBI36
87-451
CGGCGGGGAGACCGCAGCTCCGGGG A → G CTTCTGCTTCAGCGCTGAGGTCCGC
+ 
 
n=
A/A=
A/G=
G/G=
G=
126
19
34
10
0.429
130
16
36
13
0.477
136
15
35
18
0.522
134
17
37
13
0.470
PMT-272

Transmembrane prediction:

Non-synonymous amino acid changes shown in red, indels (insertions and deletions) in blue, and synonymous changes in green. Exon(s) indicated by black outlines.